A STUDY ON THE FUNCTIONS OF THE ElB MINOR PRODUCTS OF ADENOVIRUS TYPE 5 



A STUDY ON THE FUNCTIONS OF 


THE ElB MINOR PRODUCTS OF ADENOVIRUS TYPE 5 


by 


STEVEN ARTHUR BROWN 


A Thesis 


Submitted to the School of Graduate Studies 


in Partial Fulfilment of the Requirements 

• 

for the Degree 

Master of Science 

McMaster University 



Master of Science McMaster University 
(Biology) Hamilton Ontario 

Title: A Study on the Functions of the Elb Minor Products 
of Adenovirus Type 5 

Author: Steven Arthur Brown, B.Sc. (Laurentian University 
Sudbury, Ontario) 

Supervisor: Dr P.E. Branton 

Number of Pages: xiv, 122 

ii 



ABSTRACT 


The Elb transforming region of Adenovirus type 5 encodes minor products of 

93R and 156R in addition to the more abundant proteins 176R, 496R, and 84R. The 

goal of this study was to elucidate the function of 93R and 156R to gain a better 

understanding of their role in oncogenic transformation and productive infection. 

Mutant viruses were constructed, whose normal splicing pattern was disrupted by 

point mutations in the 3' acceptor sites for the 1.26 and 1.31Kb mRNAs, which code 

for the 156R and 93R products, respectively. In the construction of these mutations, 
' 

it was necessary to ensure that they did not affect the coding region for 496R. These 

mutants produced transformed foci in primary rat kidney cells with wild type 

efficiencies in DNA-mediated transformation assays. In the mutant designed to 

eliminate 156R, although the two wild type 156R species were absent, two new 

species running slightly faster on SDS-PAGE were detected. These proteins were 

recognized by sera specific to both the N- and C-termini of 496R, suggesting the 

utilization of an in-frame cryptic splice acceptor site. Use of this site probably 

resulted in the production of a mRNA encoding a modified 156R. These mutant 

proteins also seemed to be produced at the expense of 496R. The mutant designed 

to eliminate 93R grew with titres equivalent to wild type dl309, yet it was not clear 

whether a modified protein was produced in this case as well. 

iii 



TO MY PARENTS WHO SUPPORTED ME 


WITH THEIR LOVE AND UNDERSTANDING 


iv 




ACKNOWLEDGEMENTS 


I would like to thank my supervisor Dr. P.E. Branton for his support and 

encouragement throughout the study. I would also like to thank Drs. F.L. Graham 

and S.T. Bayley for their sitting on my committee and their swift arrangement of my 

defence. 

Special thanks are extended to a number of others. Namely to Ketty Sartorio for 

her advice on all matters and her shoulder to cry on, to Josie Maljar for her warm 

friendship and her guarantee, and to Jane McGlade for her guidance and the swift 

kicks to the * * * * when I needed them most. I would also like to thank my co­

workers David Dankort, Dan Dumont, Bruce Rowley, Whynn McLorie, Steve 

Whalen, Cay Egan, Dominique Barbeau, Todd Halliday, Dennis Takayesu, Monic~ 

Graham, and Silvia Cers for their support, advice, and especially their friendship. 

Thanks to all the others who touched my life: Mark, Craig S., Barb, Phil K, Tom 

H., Mike and Debs, Kim, Tania, Lloyd, Craig B., Steve P., Steve and Chris P., Sue, 

Nancy, Chris M., Magda, Mary T., PatS., Jeff M., Mike B., The Beer Club Regulars, 

The Natural Killers, and all the other wonderful people for whom I don't have the 

room to mention here, who I've been privileged to know during my time here at 

Mac. 

v 



TABLE OF CONTENTS 

PAGE 

1. INTRODUCTION 

1.1 Adenoviridae 1 

1.1.1 Adenoviruses 1 

1.1.2 Classification of Adenoviruses 2 

1.1.3 Structure of the Virion 3 

1.1.4 Lytic Infection 5 

1.1.5 Structure of the Genome 6 

1.1.5.1 Early Region 1 7 

1.1.5.2 Early Region 1a 12 

1.1.5.3 Early Region 1b 14 


1.2 Eukaryotic mRNA Splicing: A Background 20 


1.3 Rationale and Approach to Study 23 


2. MATERIALS AND METHODS 

2.1 Bacterial Strains 25 


2.2 Bacterial Culture 25 

2.2.1 Liquid Culture 25 

2.2.2 Solid Culture 26 

2.2.3 Culture Storage 26 


2.3 M13 Mutagenesis 27 

2.3.1 Preparation of Competent Cells 27 

2.3.2 Transformation with M13 28 

2.3.3 Plating of Transformants 28 

2.3.4 Titering the M13 Phage 29 

2.3.5 Growth of the Uracil-Containing Phage 29 

2.3.6 Extraction of DNA 30 

2.3.6.1 Large Scale Preparation of RF DNA 30 

2.3.6.2 Small Scale Preparation of RF DNA 31 

2.3.6.3 Large Scale Preparation of Single 


Single Stranded DNA 32 

2.3.7 Synthesis of the Mutagenic Strand 33 

2.3.7.1 Construction of the Mutagenic 


Oligonucleotides 33 


Vl 



2.3.7.2 Phosphorylation of the Oligonucleotide 33 
2.3.7.3 Annealing of the Primer to the Template 34 
2.3.7.4 Synthesis of the Complementary DNA Strand 34 
2.3.8 Growth of Resultant Plaques 35 

2.4 Cesium Chloride Banding of Large-Scale Plasmid 
DNA Preparations 35 

2.5 Determination of DNA Concentration 36 

2.6 Enzyme Reactions 37 
2.6.1 Restriction Endonuclease Digests 37 
2.6.2 T4 DNA Ligase 38 

2.7 DNA Gel Electrophoresis 38 
2.7.1 Agarose Gel Electrophoresis 38 
2.7.2 Polyacrylamide Gel Electrophoresis 38 
2.7.3 Extraction of DNA Fragments from 

Polyacrylamide Gels 39 

2.8 DNA Sequencing 39 
2.8.1 Annealing the Primer to ssDNA 40 
2.8.2 Annealing the Primer to dsDNA 40 
2.8.3 Sequencing Reactions 40 
2.8.4 Gel System 41 

2.9 Tissue Culture 42 
2.9.1 Media and Equipment 42 
2.9.2 Cell Lines 43 
2.9.3 Passaging of Cells 43 

2.10 Transformation of Primary Baby Rat Kidney 
(BRK) Cells 44 

2.10.1 Preparation of BRK Cells 44 
2.10.2 DNA-Mediated Transfection of BRK Cells 45 

2.11 Rescue of Mutations into Infectious Virus 46 
2.11.1 Transfection of 293 Cells 46 

2.12 Screening of Viral Recombinants 4 7 
2.12.1 Harvest of Plaque Isolates 47 
2.12.2 Harvest of Liquid Infections and 

Extraction of DNA 47 
2.12.3 Southern Blot Analysis 49 

Vll 



2.13 Plaque Purification of Viral Recombinants 50 


2.14 Determination of Virus Titres 50 


2.15 Protein Analysis 51 

2.15.1 Preparation and Infection of Cells 51 


2.15.2 Antisera and Immunoprecipitation 51 

2.15.3 SDS Polyacryamide Gel Electrophoresis 52 


3. RESULTS 

3.1 Characterization of the Minor E1b Products 54 


3.2 Site Directed Mutagenesis of the 3' Splice 

Sites of the 1.26 and 1.31Kb Messages 54 


3.2.1 Cloning into M13 54 

3.2.2 Oligonucleotide-directed Mutagenesis 60 

3.2.3 Rescue of Mutated Sequences into pXC38 69 


3.3 DNA-Mediated Transformation of Primary Rodent 

Cells 76 


3.4 Rescue of the Mutations into Virus 79 


3.5 Analysis of the Proteins Produced by the 

Mutants · 83 


3.5.1 An Overview of the Anti-Peptide Sera Used 83 

3.5.2 Determination of the Proteins Produced 86 


3.6 Effects of the Mutations on Productive 

Infection 96 


4. DISCUSSION 

4.1 The Efects of Mutations in Splice Sites 98 


4.2 The 156R Splice Mutant 101 

4.2.1 The Potential Existance of a Cryptic Site 


for the 156R Splice Mutant 101 

4.2.2 The Effects of the Use of the Cryptic Site 


on Protein Production 102 


Vlll 



104 4.3 The 93R Splice Mutant 

4.4 Conclusions, Criticisms, and Future 
Considerations 105 

5. REFERENCES 108 

IX 



LIST OF FIGURES 

1 Transcription Map of Group C Adenoviruses 9 

2 The Adenovirus 5 E1 Transcription Unit 11 

3 Mechanism of mRNA Splicing 22 

4 Scematic Representation of the Plasmid pXC38 56 

5 Cloning into and out of M13 59 

6 M13 Mutagenesis 62 

7 The Introduction of the Mutations into the 
Adenoviral Sequence 66 

• 

8 The Expected Restriction Fragments of the M13 
Vectors 

9 Restriction Pattern of the Wild Type and Mutant 
M13 Vectors 

68 

71 

10 Dideoxynucleic acid Sequencing of the Region 
Surounding the 93R Splice Acceptor Mutation 73 

11 Didioxynucleic acid Sequencing of the Region 
Surrounding the 156R Splice Acceptor Mutation 75 

12 Rescue of the Mutated Sequences into pXC38 78 

13 Rescue of the Mutations into Virus 82 

14 Southern Blot Analysis of the 156R Mutation 
Mter rescue into Virus 85 

15 Immunoprecipitation of Infected Cell Extracts 
Labelled with 35S-Methionine 90 

16 Immunoprecipitation of Infected Cell Extracts 
Labelled with 35S-Methionine, with and 
without peptide chases (dark exposure) 92 

X 



95 

17 Immunoprecipitation of Infected Cell Extracts 
Labelled with 35S-Methionine, with and 
without peptide chases (light exposure) 

xi 



LIST OF TABLES 


1 Classification of Adenoviruses 4 


3 Transformation of BRK Cells by Mut~mt and 


5 Plaque Titres on HeLa and 293 Cells by 


2 The Genetic Code, Displaying Its Degeneracy 64 


Wild Type Ad5 Elb Genes in El Plasmids 80 


4 Summary of Anti-peptide Sera Used 87 


Mutant and Wild Type Viruses 97 


xii 



LIST OF ABBREVIATIONS 


Ad2, 5, 12, etc. 
NH4Cl 
bp 
BRK 
BSA 
CaC12 
CASA 
eDNA 
CsCl 
cpm 
dATP,dCTP,dGTP,dTTP 
dCMP 
DBP 
ddH20 oc 
dl 
DNA 
dsDNA 
DIT 
E1, E2, E3, E4 
EDTA 
et al. 
EtBr 
FCS 
Fig 
g 
HA 
HCl 
HS 
KCl 
~HP04 

KH2P04 
Kd 
LiCl 
M 
MgC12 
MgS04 
J.LCi 
J.Lg 
J.LL 

X1ll 

Adenovirus type 2, 5, 12, etc 
ammonium chloride 
base pairs 
baby rat kidney 
bovine serum albumin 
calcium chloride 
casamino acids 
copy DNA 
cesium chloride 
counts per minute 
deoxynucleotide triphosphate 
deoxycytosine monophosphate 
DNA binding protein 
double distilled water 
degrees celsius 
deletion 
deoxyribonucleic acid 
double stranded DNA 
dithiothreitol 
early regions 1, 2, 3, and 4 
ethylenediamine tetracetic acid 
and co-workers 
ethidium bromide 
fetal bovine serum 
figure 
gram 
hemagglutination 
hydrochloric acid 
horse serum 
potassium chloride 
di-potassium hydrogen 
orthophosphate 
potassium phosphate 
kilodaltons 
lithium chloride 
molar 
magnesium chloride 
magnisium sulfate 
microcuries 
micrograms 
microlitres 



MEM 
mg 
mL 
mM 
mmol 
IDOl 

mRNA 
mu 
MW 
N 
N2 
ng 
NaCl 
Na2HP04 
NaOAc 
NaOH 
NCS 
OD 
ORF 
PAGE 
PBS 
PEG 
Pen-Strep 
pfu 
pmol 
pol 
pl 
p-TP 
R 
Rb 
RNA 
rpm 
s
35s 
SDS 
sse 
ssDNA 
SSPE 
SV40 
TBE 
TE 
TH 
tk 
Tris 

minimal essential medium 
miligrams 
mililitre 
milimolar 
milimoles 
multiplicity of infection 
messenger RNA 
map units 
molecular weight 
normal 
nitrogen 
nanograms 
sodium chloride 
di-sodium hydrogen phosphate 
sodium acetate 
sodium hydroxide 
newborn calf serum 
optical density 
open reading frame 
polyacryamide gel electrophoresis 
phosphate buffered saline 
polyethylene glycol 8000 
penicillin-strepomycin 
plaque forming units 
picomoles 
polymerase 
post infection 
preterminal protein 
amino acid residue 
retinoblastoma 
ribonucleic acid 
rotations per minute 
sedimentation coefficient 
sulfur-35 
sodium dodecyl sulphate 
saline sodium citrate 
single stranded DNA 
saline sodium phosphate EDTA 
simian virus type 40 
tris borate buffer 
tris-EDTA buffer 
hybridization temperature 
thymidine kinase 
tris (hydroxymethyl) aminomethane 

XIV 



uv ultra violet 
v volts 
wt wild type 
w/v weight per volume 
32p phosphorus-32 

XV 



1 Chapter 1 Introduction 

INTRODUCTION 

1.1 Adenoviridae 

1.1.1 Adenoviruses 

Human adenoviruses were first identified and isolated by Rowe eta!. (1953) 

as a cytopathogenic agent from adenoids undergoing spontaneous degeneration 

in tissue culture. Rowe et a!. (1953) proposed that this agent be called the 

"adenoid degeneration agent" or "A D. agent", with the current name of 

Adenovirus being adopted in 1956 (Enders et a!., 1956). Adenoviruses were 

subsequently found to be the causative agents for other diseases such as acute 

respiratory diseases (Dingle et al.,1968), epidemic keratoconjunctivitis (Hogan 

eta!., 1942; Jawetz 1959), acute haemorrhagic cystitis (Numazaki et al., 1973), 

and gastroenteritis (Fox et al., 1969), among others. Interest in adenoviruses was 

kindled by the discovery that human adenovirus type 12 (Ad12) could cause 

tumours in newborn hamsters (Trentin et a!., 1962). This was the first 

demonstration of a human pathogenic agent inducing tumours in animals and 

in the years following this discovery it was shown that oncogenicity was a 

property of other Ad serotypes as well, in a number of different rodent species 

(Heubner eta!., 1962, 1965; Girardi et al., 1964; Larsson et al., 1965; Pereira et 

a!., 1965; Rabson et a!., 1964; Trentin et a!., 1968). Not ~11 human adenovirus 



2 Chapter 1 Introduction 

serotypes can induce tumours in rodents but all are able to transform primary 

rodent cells in culture (Freeman et aL, 1967; McAllister et aL, 1969a,b), with the 

resulting transformed cell able to induce tumours upon injection into rodents, 

especially if the serotype is oncogenic or if the animal is immunosupressed or 

immunoincompetent (Branton et aL, 1985; Freeman et aL, 1967; Gallimore, 

1972; Gallimore et aL, 1977). To date it seems that human Ads have not been 

associated with tumours or other cancers in humans (Green et aL, 1980), thereby 

serving as a safe model system to study oncogenesis and other cellular processes. 

1.1.2 Classification of Adenoviruses 

The family Adenoviridae is divided into two genera, Mastadenovirus 

(mammalian) and Aviadenovirus (avian) (Norrby et aL, 1976). This classification 

is based on immunological properties of antigenic determinants on surface 

proteins of the virion capsid, such as the hexon, fibre, and penton polypeptides 

(Norrby and Wadell, 1969; Wadell and Norrby, 1969; Philipson et aL,1975; 

reviewed in Ishibashi and Y asue, 1984 ). 

There are currently 42 serotypes of human adenoviruses, which are 

separated into different groups based on certain biological and structural 

properties. Originally adenovirus serotypes were subclassified into 4 groups 

based on hemagglutination (HA, the determinant being the fibre polypeptide) 

of rat and rhesus monkey erythrocytes (Rosen, 1960), and updated by Heirholzer 



3 Chapter 1 Introduction 

(1973). Other classifications have been based on G+C content (Pina and Green, 

1965), oncogenicity (Green, 1970), molecular weights of polypeptides V, VI, and 

VII (Wadell, 1978), and DNA homology (Green et aL, 1979). Table 1.1 shows 

the overall classification of human adenoviruses. Briefly, the adenoviruses have 

been classified into the highly oncogenic group A, the weakly oncogenic group 

B, and the non-oncogenic groups C, D, E, F, and G. Most of the research to 

date has involved Ad2 and AdS from group C and Ad 12 from group A The 

present study was centered on AdS, thus the remainder of this discussion will be 

concerned with this group C virus and the closely related Ad2 serotype. 

1.1.3 Structure of the Virion 

Adenoviruses are non-enveloped and possess an icosahedral shape, with 20 

triangular surfaces and 12 vertices (Home et aL, 1959). The virion is made up 

of at least nine different polypeptides (Maize! et aL, 1968). Some of these 

proteins associate to form the capsid, which is made of 252 subunits called 

capsomeres, of which 240 are trimeric "hexons" that make up the 20 surfaces and 

30 edges and 12 are "pentons" that form the 12 vertices (Ginsberg et aL, 1966). 

The central surfaces or" facets" are made up of groups-of-nine (GON) hexons, 

which are released if the capsid is dissociated under gentle conditions (Prage et 

aL, 1970). Protein IX, which is encoded partially within Early Region 1b (see 

below), is the "glue" that holds the GON's together and is found as a trimer 



4 

TABLE 1.1: CLASSIFICTION OF ADENOVIRUSES 

Slb- Species DNA Apparent molecular Hemaggluti~tion Oncogenicity 
genus weight of the major pattern in newborn 

Homo- G+C # internal polypeptides hamsters 
X of Smal ~~ fragmenti v VI VII 

A 12,18 31 43-69 
(8-20) 

48 4-5 51­
51.5K 
46.5­
48.5K4 

25.5­
26K 

18K IV High (tliOOurs 
in most 
animals in 
4 months 

85 3,7,11,14, 
16,21,34, 
35 

89-94 
(9-20) 

51 8-10 53.5­
54.5K 

24K 18K \Jeak (tliOOUrs 
in few animals 
in 4-8 months 

c 1,2,5,6 99-100 
(10-16) 

58 10-12 48.5K 24K 18.5K Ill nil 

D5 8,9,10,13, 94-99 
15,17,19, (4-17) 
20,22,23, 
24,25,26, 
27,28,29, 
30,32,33, 
36,37,38,39 

58 14-16 50­
5o.5.t' 

23.2K 18.2K II nil 

E 4 (4-23) 58 16-19 48K 24.5K 18K Ill nil 

F 40 n.d. n.d. 9 46K 25.5K 17.2K IV nil 

G 41 n.d. n.d. 11-12 48.5K 25.5K 17.7K IV nil 

not classified: Ad 42 

1 Per cent homology within the group and in brackets: homology with members of other groups 


2 DNA fragments were analysized on 0.8-12X agarose gels. DNA fragment smaller than 400bp not resolved 


3 1, complete agglutination of monkey erythrocytes ; II complete agglutination of monkey erythrocytes; 

111, partial agglutination of rat erythrocytes (fewer receptors); IV agglutination of rat 

erythrocytes only after addition of heterotypic antisera. 


4. Polypeptide V of Ad 31 was a single band of 48K 

5 Only DNA restriction and polypeptide analysis have been performed on Ad 32 - Ad 39 

6 Polypeptides V and VI of AdS showed apparent molecular weights of 45K and 22K respectively. Polypeptide 
V of Ad30 showed an apparent molecular weight of 48.5K. 

Modified from Wadell (1980) 



5 Chapter 1 Introduction 

between adjacent hexons (Furcinitti et al., 1989). The penton consists of a 

pentameric penton base polypeptide, from which projects a trimeric fibre, and 

5 hexon molecules, which surround the base (J. van Oostrum and R.M. 

Burnett, 1985). 

1.1.4 Lytic Infection 

The early events of lytic infection, from the introduction of the virus to the 

cell to the presence of "naked" viral DNA in the cell's nucleus, are completed 

within 2 hours at 37°C (Lonberg-Holm and Philipson, 1969). Within 30 minutes 

upon infection, potentially thousands of virus particles are attached to the cell 

via an interaction between the fibre of the virus and a specific cell membrane 

receptor (Lonberg-Holm and Philipson, 1969; Philipson, 1967; Wohlfart et al, 

1985). Attachment is soon followed by penetration of the cell by viropexis, or the 

formation of endocytic membrane vacuoles containing the virus ( Chardonnet and 

Dales, 1970). The endocytic vesicle then ruptures, releasing the virus, probably 

due to a lowering of the pH, that results in an alteration of the virion surface, 

causing rupture (Pas tan et al, 1987). Release of the virus also results in a partial 

uncoating of the viral capsid as seen by an increased sensitivity to DNase and 

by density measurements (Lawrence and Ginsberg, 1967; Sussenbach, 1967). The 

uncoating seems to involve the loss of the penton capsomeres and occurs largely 

at the perinuclear region (Chardonnet and Dales, 1970; Dales and Chardonnet, 



6 Chapter 1 Introduction 

1973; Morgan et aL,1969; Sussenbach, 1967), with the entire process of 

penetration, release, and uncoating occurring with a half life of 15 minutes 

(Lonberg-Holm and Philipson, 1969). Further studies showed that actual 

transport to the nucleus most probably occurs by means of microtubules (Dales 

and Chardonnet, 1973; Luftig and Weihing, 1975). The uncoated virion, which 

is attached at the nuclear pore complex, releases its nucleoprotein core into the 

nucleus through the nuclear pores (Chardonnet and Dales, 1970; Chardonnet 

and Dales, 1972). The viral DNA may then associate with cellular histones, 

following loss of the core proteins, with the final structure appearing very much 

like the cellular nucleosome arrangement (Tate and Philipson, 1979), although 

these results have been recently challenged (Wong and l!~'-1 , 1988). 

The replicative cycle for adenoviruses is separated into early and late phases. 

The early phase commences 45 minutes post-infection (p.i.) with the 

transcription of E1a, while the other early regions (see below) are transcribed 

by 2-3 hours p.i., and many continue to be transcribed well into the late phase, 

which starts with the onset of viral replication, at about 6 hours p.i. (Nevins et 

al., 1979). One virus cycle is completed in 32-36 hours. 

1.1.5 Structure of the Genome 

The Adenovirus genome is a linear, double-stranded, DNA molecule, with 

a molecular weight of 20-25 X 106 (Green et al., 1967) and an approximate 



7 Chapter 1 Introduction 

length of 36,000 base pairs (Ads 2 and 5) (Akusjarvi et aL, 1984; Alstrom et al., 

1984; Gingeras et aL, 1982; Roberts et aL, 1984). The 5' end of each DNA strand 

is covalently linked to a 55Kd terminal protein via a dCMP phosphodiester 

bond, that is thought to, along with its 80Kd precursor, play a role in replication 

(Rekosh et aL, 1977; Robinson et aL, 1973). 

Adenovirus transcripts are made from a series of temporally organized 

regions, which are transcribed by RNA polymerase II . These regions include 

immediate-early (E1a), delayed early (E1b, E2a, E2b, E3, and E4), intermediate 

(IVa2, and IX), and late (L1-5) regions on both the 1 and r strands (see Figure 

1.1). 

1.1.5.1 Early Region 1 

Early region 1 (E1) corresponds to the left-hand 11.2% of the adenovirus 

genome and is responsible for the control of many viral and cellular processes 

(Figure 1.2). The E1 region is comprised of two transcription units on the r 

strand, E1a and E1b. E1a and E1b are independently promoted, with E1a 

extending from 1.3 to 4.5 and E1b from 4.6 to 11.2 map units (Berk and Sharp, 

1977, 1978; Chow et aL, 1979; Wilson et al., 1979). 

In determining the portion of the adenoviral genome required for 

transformation of primary rodent cells, Gallimore et al (1974) found that the E1 

sequences were the only sequences consistently expressed in transformed cell 



8 

Figure 1.1: Transcription Map of Group C Adenoviruses. A schematic 

representation of the Ad 5 genome, with transcription units from the 

r and I strands represented above and below the central lines, which 

are divided into 100 units. The messages are shown with a capped end 

representing the initiation site, an arrow representing the 

polyadenylation site, and gaps representing splicing. The messages 

designated E represent the early regions, while those designated L 

represent late regions. All the late messages are promoted from the 

major late promoter at 16.3 and contain the triparted leader indicated 

1, 2, and 3. Polypeptides encoded on the messages are listed above and 

below their corresponding mRNA and are shown in either number of 

amino acids (R) or kilodaltons (K, molecular weight) or with a Roman 

numeral in the case of some of the late proteins. 



Proteins 

RNAs 

SSR 
171R 
217R 
243R 
289R 

E1A._ 

IX 
131R 
168R 
84R 
156R 
93R 
496R 

E1B · __.__ 

1 

13.6K 

2 3 

52· 
SSK lila 

I II 
VA 

penton 
Ill 

core 
,..-r , 

pVII V 

1 
L2 

pTNaee 

hex on 
pVI II 23K 

L3 

non-virion 

33K 
100K pVIII 

-a 
L4 

1.41( 
14.5K 
11K 
10K 
16K 

E3 

fiber 
IV 

LS 

RNAs 

+- -] 

-J 
-:I 

-:I 

E4 

-J 

''"---v---~J 
E2A 

Proteins 

1Va2 140K 
pol 

87K 
p-TP 

E2B 

12K 
OBP 

- :] 
11K 
13K 
17K 
10K 
14K 

( 19K,21 K,24K,35Kl 



10 

Figure 1.2: The Adenovirus 5 E1 Transcription Unit. Shown are the 

independantly promoted E1a and E1b transcription units. The region 

on the genome is shown in both map units and base pairs from the 

left end. Open reading frames are shown by open or shaded boxes 

indicating different reading frames. The mRNAs are shown by solid 

lines, while spliced regions are indicated by the dashed lines. Beside 

the mRNAs and proteins are given the corresponding sedimentation 

values and residue numbers, respectively. For the E1b messages the 

splice donors and acceptors are given below: 22S (donor= 3510, 

acceptor= 3595), 13S (d= 2255, a= 3595), 14S (d1= 2255, a1= 3275, 

d2= 3510, a2= 3595), 14.5S (d1= 2255, a1= 3216, d2= 3510, a2= 

3595),and 0.86Kb (d= 2090, a= 3595). Adapted from Ulfendahl etl!L., 

(1987) and Lewis and Anderson, (1987). 



E1A E1B 


map units 

1000 

289R ,....---------, 1\ ,...,---..., 

13S 

243R I' 

12S -=========~/ '='======~ 

217R 

11S 


171R /' /' 


10S c:::::J/ ' I 11 , =====~ 


., 
55R ,....--, ,. ,. ' 

..__. ,. ',.9S ---- ­

4000 base pairs 2000 3000 

" 176Rliiiiiijiii.iiC.:::::::::::::::::: , ~------ 496Rr; , ,~ , ..:.:.::::,0:,~:, ::' 
22S 

13S 
176R 
84R 

14S 
176R 
156R 

14.5S 
176R 
93R 

proposed--- --- ------ --- ........ _ 0.86Kb 


liiiiiiiiiil.ii.f.,. ~~!!= 

i iiiiiiiiiiiii gsProtein IX 



Chapter 1 Introduction 12 

lines. The E1 region was also determined to be the only sequences required for 

DNA mediated transformation (Graham et aL, 1974b) Specifically, it was found 

that the Hind ill-G fragment, which encompasses E1a and part of E1b (approx. 

8% of the genome), was sufficient for oncogenic transformation in DNA 

mediated assays (Graham et aL, 1974a; Schrier et aL, 1979; Shiroko et aL, 1977; 

Yano et al., 1977). Because of the association of region E1 with oncogenic 

transformation, much research has been conducted on this region to elucidate 

the function(s) of proteins encoded by E1 and to determine their role in 

transformation. 

1.1.5.2 Early Region 1a 

As outlined above, E1a proteins are the first viral gene products to be 

expressed. Through alternative splicing (see Figure 1.2), the E1a region produces 

five mRNAs, which sediment at 13S, 12S, llS, lOS, and 9S (Berk and Sharp, 

1978; Perricaudet et al., 1979; Stephens and Harlow, 1987; Ulfendahl et aL, 

1987). The 13S and 12S messages predominate and produce two highly related 

gene products of 289 and 243 residues (R), respectively, differing only by the 46 

amino acid unique region in the 13S product (Perricaudet et al., 1979). These 

two proteins, located in the nucleus of infected cells (Feldman and Nevins, 1983; 

Schmitt et al., 1987; Yee et al., 1983), run on a SDS-polyacrylamide gel as a 

family of heterogeneous polypeptides due to differences in phosphorylation 



Chapter 1 Introduction 13 

(Richter et aL, 1988; Tremblay et aL, 1989, 1988; Yee et aL, 1983) These 

proteins have nominal molecular weights of 52 and 48.5Kd for the 13S product 

and 50 and 45Kd for the 12S product (Rowe et aL, 1983; Smart et aL, 1981; Yee 

and Branton, 1985a). The llS and lOS messages encode proteins of 35 and 

30Kd, respectively, which are produced later in infection (Stephens and Harlow, 

1987; Ulfendahl et al., 1987). The 9S message splices into a different reading 

frame to produce a protein of 6.1Kd, with a novel C-terminus (Virtanen and 

Pettersson, 1983). 

Proteins from the Ela region have a number of functions in lytic infection. 

One of the primary functions is the transactivation of other genes, mainly the 

other early viral genes, including Ela itself (Berk et aL, 1979; Jones and Shenk, 

1979; Nevins, 1981). The transactivation region is located mainly in the unique 

region (conserved region 3) of the larger 13S product, which is both necessary 

(Culp et al., 1988; Jelsma et aL, 1988) and sufficient for transactivation (Lillie 

and Green, 1989). Ela products are also able to repress transcription (Borelli 

et aL,l984), with the 12S product being the major protein involved (Lillie et aL, 

1986). 

The role of Ela in transformation has been extensively studied and although 

Ela on its own is incapable of fully transforming primary rodent cells, it 

possesses an immortalizing function (Houweling et aL, 1980). To obtain fully 

transformed cells, Ela must cooperate with another oncogene, such as Elb or 

Ha-ras, or other viral genes, such as polyoma middle-T (Land et aL, 1983; Ruley, 



Chapter 1 Introduction 14 

t983). If, however, Eta is expressed at high levels in the cell, growth properties 

and morphology of fully transformed cells have been reported in established 

cell lines (Senear and Lewis, t986), although these cells were not tested for 

tumourgenicity. 

Eta is also known to be associated with certain cellular proteins of 65, 68, 

105, t07, and 300Kd (Egan et aL, t987,t988; Yee and Branton, t985b). The 

identities of these proteins are unknown, with the exception of the lOSKd 

protein, which was identified as the product of the recessive oncogene Rb-t 

(Whyte et aL, t988), whose binding to E1a products seems to be required for 

transformation by adenoviruses (Egan et aL, t989;Jelsma et aL, 1989). 

1.1.5.3 Early Region tb 

Products of the E1b transcription unit (Figure 1.2) are expressed from two 

overlapping open reading frames (ORFs). The nucleotide and residue numbers 

given below are for AdS, although details on the minor messages were originally 

obtained from the Ad2 system. The first ORF, which starts at nucleotide t7t4, 

encodes a protein 176 residues (R). The second ORF encodes a protein of 

496R, which starts at nucleotide 2019, and which is encoded on a different 

reading frame (Bos et aL, t98t; Gingeras et aL, t982). The t76R protein 

migrates on SDS-PAGE as a 19Kd doublet in SDS-polyacrylamide gels (Rowe 



Chapter 1 Introduction 15 

et aL, 1983; McGlade et aL, 1987), while the 496R proteins runs at 58Kd. These 

species are often referred to as the 19K and 58K proteins. Two major E1b 

mRNA species of 22S (2.2 Kb) and 13S (1.0 Kb) exist, which share common 5' 

and 3' termini as a result of alternative splicing of a common precilrsor (Berk 

and Sharp, 1978; Chow et aL, 1979; Kitchingham and Westphal, 1980; 

Perricaudet et aL, 1980). The 22S and 13S messages are under temporal control, 

with the 22S message being the most abundant E1b message early in infection, 

with the 13S message becoming the predominant message at later times (Spector 

et aL, 1978). This temporal control seems to be regulated at the level of RNA 

splicing (Mantell et aL, 1984). While the 496R protein is encoded only by the 

22S mRNA, the 176R product i~ encoded by both of the major E1b messages 

(Bos et aL, 1981; Esche et aL, 1980). Other E1b messages that encode 176R 

include two minor mRNAs of 1.26 Kb and 1.31 Kb, which also encode proteins 

of 156R and 93R, respectively. The 156R protein shares both amino and 

carboxyl termini with the 496R, while the 93R protein possesses the amino 

terminus of 496R and a novel carboxyl terminus due to splicing into a different 

reading frame (Anderson et al.,1984; Lewis and Anderson, 1987). The 13S 

message also encodes an 84R protein that shares the same amino terminus as 

496R, 156R and 93R, while splicing into a third reading frame, yielding a 

different carboxyl terminus from 496R (Green et aL, 1982; Lucher et aL,1984; 

Matsuo et al., 1982). There may exist a fourth mRNA of 0.86 Kb, which, like the 

other messages, starts at nucleotide 1701 (Baker and Ziff, 1981), but uses a 



Chapter 1 Introduction 16 

different splice donor to produce possible 176R-and 496R-related products 

(Lewis and Anderson, 1987). Within the region encompassed by E1b is found 

the gene for protein IX, which is transcribed as a 9S mRNA from its own 

promoter and is expressed late in infection (Pettersson and Mathews, 1977). 

The 176R protein has been found to be acylated (McGlade et aL, 1987) 

and phosphorylated (McGlade et aL, 1989). Immunofluorescence has shown 

176R to be subcellularly localized to the nuclear membrane and perinunclear 

region (McGlade et al. ,1987), as well as with intermediate filaments, which, 

along with the nuclear lamina, are disrupted upon transient expression of the 

176R protein (White and Cipriani, 1989). The 176R product plays an important 

role in viral growth as was shown by complementation of E1b deletion viruses 

by fragments containing 176R but not 496R (Klessig et aL, 1982) and by a 

mutation in this region that is reduced for late polypeptide synthesis (Pilder et 

aL, 1984). Mutations in the coding region for 176R display interesting 

phenotypes. First of all, such mutants cause rapid cell lysis and a cytopathic 

effect (cyt phenotype) (Pilder et al., 1984; Subramanian et al., 1984; Takamori 

et aL, 1968; White et aL, 1984, 1987) that is associated with the formation of 

large plaques (Chinnadurai, 1983; Subramanian et aL, 1984). Secondly, mutants 

in 176R are associated with the degradation of viral and cellular DNA (deg 

phenotype) (Ezoe et al., 1981; Lai Fatt et aL , 1982; Pilder et al., 1984; White et 

al., 1984). From these and other data, 176R has been implicated in the 

stabilization or protection of newly replicated viral DNA and thus directly or 



Chapter 1 Introduction 17 

indirectly prevents degradation by a cellular nuclease, allowing increased 

expression of viral genes (Herrmann and Mathews, 1989). Finally, it seems that 

176R may have a transactivation function as well that may affect a number of 

cellular and viral promoters including E1a and E1b, itself (Herrmann et aL, 

1987; Jochemsen et al., 1987; Yoshida et aL, 1987). 

The 496R protein is a phosphoprotein (Malette et aL, 1983) located in the 

nucleus and the perinuclear region (Rowe et aL, 1983) and has been implicated 

in a number of viral processes. Firstly, the 496R product appears to affect the 

transport to and accumulation of viral messages in the cytoplasm by facilitating 

transport of or by stabilizing late viral mRNAs, while having the opposite effect 

for cellular messages (Babiss et al., 1985; Pilder et aL, 1986). The 496R protein 

also plays a role, although poorly understood, in the shut-off of host protein 

synthesis (Babiss and Ginsberg, 1984). Finally, 496R is known to complex to a 

number of cellular and viral proteins, the most notable being the cellular protein 

p53 (Sarnow et aL, 1982) which has been suggested to be an anti-oncogene like 

Rb1 (Finlay et al., 1988, Hinds et aL, 1989). The 496R protein from Ad 5 

physically binds to p53 and concentrates in a "cytoplasmic body" consisting of 

a cluster of 8nm filaments (Sarnow et aL, 1982; Zantema et aL, 1985a,b), which 

localize as DNase sensitive structures in discrete areas of the nucleus and 

perinuclear structures that include centrosomes (Zajdel and Blair, 1988). 

Interestingly, the equivalent Ad 12 485R has not been shown to associate 

physically with p53 even though p53 is present at high levels in the nucleus of 



Chapter 1 Introduction 18 

transformed cells (Grand and Gallimore, 1984), suggesting some sort of 

stabilizing effect. The p53 protein is also known to bind to SV 40 large T antigen 

(Sarnow et al., 1982). In addition to p53, 496R also binds to a 34Kd product 

from the adenovirus E4 region (Sam ow et al., 1984) and this complex may be 

important for the accumulation of late viral messages as well as host protein 

shut-off (Halbert et al., 1985). The binding sites of these proteins on 496R are 

unknown, although the binding site of p53 on SV 40 large T has been identified 

(Scmieg and Simmons, 1988). 

Unlike E1a, E1b polypeptides cannot independently transform primary 

rodent cells or established rat cell lines, although 176R or 496R encoded on 

plasmids cooperate with E1a plasmids to transform primary r.ells (Logan et al., 

1984; Solnick and Anderson, 1982; van den Elsen et al., 1983). In fact, not much 

•
is known concerning E1b products and transformation except that both 176R 

and 496R (or at least the amino terminus) are required (Babiss et al., 1984; 

Barker and Berk, 1987; Bernards et al., 1986; Chinnadurai, 1983; Edbauer et al., 

1988; Logan et al., 1984; McLorie et al. , 1990, submitted for publication; 

Takemori et al., 1984), although it has also been suggested that either 176R or 

496R alone with E1a can transform cells at a reduced level (Bernards et al., 

1986; McLorie et al., 1990, submitted). Some studies using host range II (hrii) 

mutants, however, suggested that the 496R protein of E1b may be dispensible 

in DNA mediated transformation (Rowe and Graham, 1983). The reason for this 

discrepancy remains unclear. From the above and other data~ it has been 



Chapter 1 Introduction 19 

suggested that 176R and 496R function to transform cells by independent 

(McLorie et aL, 1990, submitted; White and . Capriani, 1990) but cooperative 

pathways (McLorie et al., 1990, submitted). 

The role of the minor 496R-related products in lytic infection or oncogenic 

transformation remains unclear. Some indirect studies have suggested that these 

proteins play little or no role in the above processes. For example, Montell et 

aL (1984) mutated the splice donor site that creates the messages that produce 

the 84R, 93R, and 156R proteins and found that the mutant was not defective 

for productive infection of HeLa cells nor was it defective for transformation of 

primary rat cells or CREF cells. These data suggested that the minor products 

are of no functional importance . Montell et al. (1984) also noted, however, 

that cryptic splice donors were used and thus modified yet functional proteins 

•may still have been produced. Thus the exact form of these proteins may not be 

important for their function (Lewis and Anderson, 1987). Also, the studies using 

the Hind III -G fragment suggest that at least the amino terminus is important 

in transformation. From the above data, it has been suggested that perhaps the 

minor E1b proteins function to vary the expression of the common amino 

terminal of 496R throughout the cell by differential localization (Lewis and 

Anderson, 1987). 

Although the function of E1b products in transformation is unclear, it is 

thought that the products of E1a somehow are able to immortalize cells, while 

E1b functions are required to establish and maintain the fully transformed 



Chapter 1 Introduction 2 0 

phenotype (Branton et al., 1985). Also, it is unclear whether 496R (and perhaps 

the minor products) functions in transformation by simply binding to p53 or by 

more complex processes. At any rate much more study is required before the 

understanding of E1b functions reaches the same level as is found with E1a. 

1.2 Eucaryotic mRNA Splicing: A Background 

Splicing of eucaryotic messages was first discovered in the Adenovirus 2 

system by RNA/DNA hybridization and electron microscopy (Berget et al., 

1977). Adenoviruses were used to study splicing as the genome was small enough 

to be easily worked with and it was known that during late stages of infection 

long viral RNA was synthesized, so it was thought that viral mRNA regulation 

may be similar to the cellular counterpart (Sharp, 1987). Soon after this 

discovery in the adenovirus system, it was revealed that cellular genes are indeed 

post-transcriptionally regulated by RNA splicing (Chambon, 1977). The 

descriptions of the adenovirus messages above reveal just how complex splicing 

of RNA can be (Sharp, 1987). 

Splicing of RNA is thought to be carried out with the formation of an 

intermediate followed by excision of the intron and ligation of the exons (see 

Figure 1.3). All introns are said to have conserved sequences at their 5' and 3' 

termini or splice sites. These sequences will always have a Guanosine-Uracil 

(GU) at the 5' end and an Adenosine-Guanosine (AG) at the 3' terminus. 



21 

Figure 1.3: Mechanism of mRNA splicing. The precusor is shown with the 5' 

splice site , 3' splice site, and branch site sequences labeled. On either side 

of the intron are the 5' and 3' exons (E1 and E2, respectively). Consensus 

sequences are shown at the various sites: A= adenosine, G = guanosine, C = 

cytosine, U = uracil, Y = pyrimidine, R = purine, and N= any nucleotide. 

Progression from step to step and as well as nucleophilic attacks on 

phosphodiester bonds by free hydroxyl groups (OH) are shown by arrows. The 

intermediate molecules are diagramed in the middle, while at the bottom are 

the two products of splicing: the discarded intron lariat and the spliced 

exons. Adapted from Sharp, (1987). 



PRECUSOR 

5' apllce alte branch alte 3' apllce alte 

~E1===A l ----~ l l !i2___.-v- IAGpGUAAGU NYR A 'f ~n)NCAG pG 

I 
IJGAAUG~GA~ 

I 
2'0H 

YNYRAv­

\ 
---­

INTERMEDIATE 

GAAuG ,
2
~AG(OH)3' 

~- \ '52 
y N y 3• ln)NCAG pG 

PRODUCTS 



Chapter 1 Introduction 2 3 

Splicing starts by the formation of a branch through a 2' -5' phosphodiester bond 

between the 5' terminal guanosine and an adenosine within the intron, 20-50 

nucleotides upstream of the 3' splice site (Grabowski et aL, 1984; Reed and 

Maniatis; Ruskin et aL, 1984). This structure is generally called the lariat 

intermediate. Formation of the branch and excision of the exon are soon 

followed by cleavage at the 3' splice site and ligation of the exons and release 

of the lariat intron (Sharp 1987). Splicing occurs through the formation of the 

spliceosome or splicing body made up of a number of particles called small 

nuclear ribonucleoprotein (snRNP) particles named U1, U2, U4, US, and U6 

(Busch et aL, 1982; Lerner et aL, 1981). The presence of and recognition of 

sequences on the RNA, by the snRNPs, are critical for splicing (Sharp, 1987). 

1.3 Rationale and Approach to Study 

At the onset of this study, very little was known of the functions of the 496R 

related products 156R, 93R and 84R, since little or no studies had been centered 

on these proteins other than their identification. It was thought that two 

approaches could be used to attempt to elucidate the function of the minor 

products. The first included the construction of the appropriate eDNA virus to 

study to what extent the various minor proteins could substitute for 496R. This 

approach still remains to be pursued. The second approach was to attempt to 



Chapter 1 Introduction 2 4 

disrupt splicing of the minor messages by mutating the splice acceptor site in the 

appropriate message. This approach was adopted in order to answer the 

question whether eliminating these messages, and thus the proteins, had any 

effect on viral functions, particularly those functions normally attributed to 

496R. This seemed the approach to take given the availability of good 

mutagenesis techniques and the development of efficient virus rescue protocols. 



Materials and Methods 25Chapter 2 

Materials and Methods 

2.1. Bacterial Strains 

Escherichia coli strains CJ236 (duf, ung-, thf, rei A-; pCJlOS(Cmr)) and 

MV1190 (delta(lac-pro AB), thi, sup E, delta(srt-rec A)306::Tn lO(te{)[F':tra D36, 

pro AB, lac IqZdeltaM15]) were obtained from Bio-Rad Laboratories and used 

in the M13 site-directed mutagenesis. 

Esche-richia coli-strain LE392 (F-··- supE44, supF58, lacYl, galT22, metBl, 

trpR55, hsdR514(Rk-Mk+))was used to grow the mutagenic plasmids. 

2.2. Bacterial Culture 

2.2.1 Liquid Culture 

Allstrains were grown in Luria-Bertani (LB) broth (lOg tryptone, Sg yeast 

extract, lOg NaCl per litre distilled water, autoclaved) with the following 

exceptions or additions. For growth of CJ236 chloramphenicol (30 J.£g/ml final 

concentration) was added or for growth of LE392 containing pXC38 ampicillin 

(10-20 g/ L) was added. Overnight (preparatory) cultures of MV1190 were grown 

in glucose-minimal salts media (6g ~HP04, 3g KH2P04, lg NH4Cl, and O.Sg 

NaCI per litre distilled water, after autoclaving and cooling, addition of 20mL 



Chapter 2 Materials and Methods 2 6 

20% CASA, 10 mL 20% glucose, 1mL 1M MgSO4, 100J.LL 1M CaC12, 100J.LL 1% 

vitamin B1, and 10 J.Lg/mL final volume tetracycline). All cultures were incubated 

at 37°C with shaking. 

2.2.2. Solid Culture 

LB plates were prepared by adding 15g Bacto agar to 1 litre LB broth 

(above). After autoclaving and allowing to cool to 42°C, the media was 

supplemented with chloramphenicol (for growth of CJ236) or ampicillin at the 

concentrations listed above. For growth and short term storage of MV1190, plates 

of glucose-minimal medium was prepared by preparing the media as above with 

the addition of 15g agar per litre prior to autoclav~g. For both types of plates the 

agar medium was poured into Fischer plastic petri dishes and, after allowing the 

agar to solidify, were stored at 4°C. For short term storage, cultures were streaked 

on the appropriate medium, inverted and incubated overnight at 37°C, after which 

plates were placed at 4°C and colonies picked and grown up as needed. 

2.2.3. Culture Storage 

150J.LL of glycerol was added to 850J.LL of an overnight liquid culture in a 4 

mL glass vial and stored at -70°C. When required, cultures were started by 

scraping the surface of the frozen stock with a sterile inoculating loop and 

transferring to a liquid culture. 



Chapter 2 M ateria/s and Methods 2 7 

2.3. M13 Mutagenesis (Taken from the Bio-rad Muta-Genetm in vitro 

Mutagenesis Kit Instruction Manual, 1987 as taken from Zoller and Smith (1983) 

and modified by Kunkel, 1985) 

2.3.1. Preparation of Competent Cells 

MV1190 was streaked on glucose minimal media plates and incubated at 

37°C, until well defined colonies appeared. For inoculant for either competent 

cell production or transformation, the day before the procedure was to be done 

lOmL of glucose-minimal medium was inoculated with a single MV1190 colony 

and incubated overnight with shaking. 200-250mL of LB broth was inoculated 

with the overnight culture to give an initial absorbence reading (As90) of 0.1 and 

incubated at 37°C with shaking. After the culture reached an absorbence (As90) 

of 0.8-0.9, the culture was harvested at 0°C for 5 minutes at 5000 rp·m. The pellet 

was resuspended in 50mL cold 100niM CaC12, using a pre-chilled pipet. The cells 

were again harvested by centrifugation and resuspended in 10mL 100mM CaC12' 

after which lOOmL 100mM CaC12 was added. The resuspension was kept on ice 

for 30-90 minutes and spun down, drained and resuspended in 12.5mL 85mM 

CaC12, 15% glycerol. Aliquots of 0.3 mL were prepared and frozen in liquid N2 

and stored at -70°C where competence could be retained for 6-9 months. The 

aliquots were thawed on ice for use. 



Chapter 2 Materials ·and Methods 28 

2.3.2. Transformation with M13 

0.3mL of competent cells were thawed on ice. 1-10ng of a cloned M13 ligation 

reaction or 3-10J.LL of a synthesis reaction after dilution with TE (see below) was 

added. The mixture was gently mixed and held on ice for 30-90 minutes. The cells 

were then heat shocked at 42°C for 3 minutes and returned to ice. Transformation 

of LE392 by plasmids was performed in the same manner. 

2.3.3. Plating of Transformants 

Plating of transformants was done immediately following transformation. The 

transformed cells were mixed well and 10, 50, or 100J.LL was added to 0.3mL of 

an MV1190 overnight culture (prepared as described above) in a sterile 13 x 100 

mm test tube. Next, SOuL of 2% X-gal which had been dissolved in dimethyl 

formamide and 20J.LL of 100mM Isopropyl-1-thio-B-D-galactoside (IPTG) was 

added to 2.5mL of LB top agar (0.7% agar) that had been cooled to 50°C. This 

mixture was then added to the transformed cells, which were then mixed and 

immediately poured on LB plates. After the top agar cooled, the plates were 

inverted and incubated at 37°C overnight. The following morning the resulting 

plaques were picked by either inserting a sterile glass pipet into the plaque and 

blowing the plug into 150J.LL of TE buffer (lOmM Tris-HCl, 1mM Ethylene­

diamine Tetraacetic acid (EDTA), pH 8.0) or by touching the tip of a sterile 

wooden rod to the plaque and transferring the phage to the same amount of TE 

buffer by vigourous shaking. Clear plaques were picked over blue plaques as they 

http:3-10J.LL


Chapter 2 Materials and Methods 2 9 

represented M13 phage with inserts as opposed to those without inserts. The 

phage was then titred and screened for the insert (see below). 

2.3.4. Titering the M13 Phage 

Serial dilutions, ranging from 10-2 to 10-10 in powers of 2, of the cloned M13 

phage were prepared. 15J,£L of each dilution was added to 0.3mL competent cells 

and 2.5mL LB top agar (as described previously) and pour plated on LB plates. 

Mter the agar solidified, the plates were inverted and incubated at 37°C 

overnight. The following morning the plaques were counted and the titre 

calculated as pfu/mL. 

2.3.5. Growth of Uracil-Containing Phage 

50mL LB broth with 30J.£g/mL chloramphenicol (150J,£L 10mg/mL stock) in 

a 500mL Erlenmeyer flask was inoculated with 500JLL overnight culture of CJ236 

and incubated at 37°C with shaking. Approximately 6 hours later 50J,£L of cloned 

M13 phage was added and the infection was allowed to continue for no longer 

than 6 hours (usually 4-5 hours) at 3rc with shaking. After this time the culture 

was harvested by centrifugation at 10,000 rpm for 10 minutes at 4°C in a Sorvall 

SS34 rotor. One quarter (1/4) volume 3.5M ammonium acetate, 20% 

Polyethylene glycol 8000 (PEG), was added to the supernatent and the mixture 

was added to a fresh centrifuge tube and held on ice for at least 30 minutes or 

overnight at 4°C. Mter the incubation the phage was pelleted by centrifugation 



c;hapter 2 Materials and Methods 3 0 

at 10,000 rpm for 15-20 minutes at 4°C (Sorvall). The supernatent was poured off 

carefully and the tube was drained thoroughly and the pellet resuspended in 100-

200J,£L TE buffer. The stock is then titred on MV1190 and 0236 and the 

efficiency of titre on each was compared. The efficiency of titre on MV1190 had 

to be at least 104 fold less than on 0236. 

2.3.6. Extraction of DNA 

2.3.6.1 Large Scale Preparation of RF DNA 

50mL LB broth was inoculated with 500J,£L MV1190 and 500J,£L (10J.£L per 

mL medium) stock cloned M13 phage and incubated at 3rc with shaking for no 

longer than 6 hours. Mter incubation the culture was harvested by centrifugation 

at 10,000 rpm for 10-15 minutes at 4°C. The supernatent was poured off and 

saved for single-stranded DNA (ssDNA). The pellet was resuspended in 1mL 

solution I (Smg/mL lysozyme (Boehringer Mannheim), 50 mM glucose, 10mM 

EDTA, and 25mM Tris-HCl pH 7.6). The resuspension was allowed to sit at 

room temperature for 5 minutes and transferred to a fresh corex tube. To the 

resuspension 2mL of freshly prepared solution II (0.2N NaOH, and 1% Sodium 

Dodecyl Sulfate (SDS)) was added and mixed gently. To the above l.SmL solution 

ill (3M Sodium Acetate (NaOAc) pH 4.8) was added, mixed gently, and placed 

on ice for 10 minutes. The mixture was centrifuged at 10,000 rpm for 20 minutes 

at 4°C (Sorvall) and the supernatant was transferred to a clean corex tube. To the 



Chapter 2 Materials and Methods 31 

supernatent was added 0.6 volume cold isopropanol. The mixture was mixed and 

set at room temperature for 15 minutes. The DNA was recovered by 

centrifugation at 10,000 rpm for 25 minutes at room temperature (Sorvall) and 

the pellet was washed in cold 70% ethanol. The pellet was dried and resuspended 

in 200tLL TE buffer and transferred to an Eppendorf tube. To the Eppendorf tube 

was added 400tLL cold 5M LiCl, the contents were mixed, and allowed to stand 

on ice for 30 minutes. The supematent was recovered and 0.1 volumes NH40Ac, 

3 volumes ethanol were added, and the DNA recovered by centrifugation in a 

microfuge (Microspin 24, Sorvall). The DNA pellet was resuspended in 80tLL TE 

buffer and 20tLL RNAse (10 mg/mL) and incubated at 37°C for 20 minutes. To 

this was added an equal volume 13% PEG, 1.6M NaCl and the conteni.s 1.eld ori 

ice for 30 minutes or overnight at 4°C. The DNA was then extracted with phenol 

twice and precipitated with 2 volumes cold ethanol. The pellet was resuspended 

in 50-200tLL TE buffer. An aliquot of the resuspension was taken and analyzed 

with the appropriate enzymes and gel electrophoresis. 

2.3.6.2. Small Scale Preparation of RF DNA 

1.5-3.0mL of LB broth was inoculated with 15-30t,£L overnight culture of 

MV1190 and 15-30tLL cloned M13 phage and incubated at 3rc with shaking for 

no longer than 6 hours. Cells were harvested by centrifugation and the pellet 

resuspended in 100tLL solution I and incubated on ice for 30 minutes. At this 

point 200tLL solution IT was added and incubated on ice for 5 minutes at which 



Chapter 2 Materials and Methods 32 

point 150JLL solution III was added, after which the mixture was held on ice for 

an additional 60 minutes. The solution was then centrifuged at room temperature 

in a microfuge and 400JLL of supernatent was removed and transferred to a new 

sterile Eppendorf tube. One mL cold ethanol was added and the tube placed at ­

70°C for 15 minutes, after which the contents were spun down in a microfuge at 

4°C and the supernatent discarded. The pellet was resuspended in 150JLL sterile 

double distilled water (ddH20) and phenol/chloroform extracted 3 times and 

ethanol precipitated (as above). The resulting pellet was dissolved in 500JLL 0.1M 

NaOAc, 0.5M Tris-HCl pH 8.0 and 2 volumes ethanol were added and the 

mixture placed at -70°C. The DNA was pelleted by centrifugation 15 minutes at 

4°C and the supernatant discarded. The ethanol precipitation was repeated and 

the resulting pellet was washed with 70% ethanol and dried by speed vac. This 

pellet was resuspended in 22.5JLL ddH20 and 2.5JLL RNase was added and 

incubated at 37°C for 30 minutes. This sample was then stored at -20°C. 

2.3.6.3. Large Scale Preparation of Single Stranded DNA 

The supernatant from the large scale preparation ofRF DNA (as described 

above) was centrifuged again at 10,000 rpm for 10 minutes at 4°C. The 

supernatant was transferred to a clean corex tube and 6.67mL 20% PEG, 2.5M 

NaCl was added to the supernatant and incubated on ice for at least 15 minutes 

or longer (about 1 hour). The phage was centrifuged at 10,000 rpm for 5 minutes 

at 4°C and the supernatant was removed by aspiration. The pellet was 



Chapter 2 Materials and Methods 3 3 

resuspended in 300J.LL TE and transferred to an Eppendorf tube. The DNA was 

extracted 3 times with phenol/chloroform and ethanol precipitated. The DNA was 

pelleted, washed with 70% ethanol, dried, and resuspended in 50J.LL TE and 

stored at -20°C until used. 

2.3.7. Synthesis of the Mutagenic Strand 

2.3.7.1. Construction of the Mutagenic Oligonucleotides 

The mutagenic oligonucleotides containing the appropriate base changes (see 

results) were prepared at the Biotechnology Institute at McMaster University. The 

absorbence (~) was measured and the oligonucleotide was lyophilized after 

synthesis. Upon delivery the oligonucleotides were resuspended in ddH20 to a 

concentration of 50 pmol/mL. 

2.3.7.2. Phosphorylation of the Oligonucleotide 

To a 0.5mL rnicrofuge tube was added 200 pmol oligonucleotide, lOOmM 

Tris (pH 8), lOmM MgC12, 5mM DTT, 0.4mM A TP (neutralized), and ddH20 

to 30J.LL. The contents were mixed and 4.5 units of T4 polynucleotide kinase was 

added. The reaction mixture was incubated at 37°C for 45 minutes and the 

reaction stopped by heating at 65°C for 10 minutes. 



r:;hapter 2 Materials and Methods 3 4 

2.3.7.3. Annealing of the Primer to the Template 

The uracil-containing ssDNA was prepared by the extraction of ssDNA 

discussed above. To a 0.5mL microfuge tube was added 0.1 pmol uracil template, 

2-3 pmol mutagenic oligonucleotide, luL lOX Annealing Buffer (200mM Tris­

HCl pH 7.4, 20mM MgC12, 500mM NaCl), and ddH20 to a final volume of 10J.£L. 

The molar ratio of primer to template was between 20:1 to 30:1. The reaction 

mixture was then placed in a 70°C water bath and the temperature was allowed 

to drop to 30°C over a 40 minute period (approx. l°C/minute). The reaction 

mixture was then placed in an ice water bath and the synthesis of the 

complementary strand performed. A second reaction was run without primer in 

order to test for endogenous priming. 

2.3.7.4. Synthesis of the Complementacy DNA Strand 

To the primed template in the ice water bath was added luL lOX Synthesis 

buffer (5mM each deoxynucleotide triphosphate, lOmM ATP, lOOmM Tris pH 

7.4, 50mM MgC12, 20mM dithiothreitol [DDT]), 2-4 units T4 DNA ligase 

(Pharmacia), 1 unit T4 DNA polymerase. The reaction was placed on ice for 5 

minutes, followed by 5 minutes at 25°C, and then at 37°C for 60 minutes. Mter 

the final incubation period, 90J,£L of TE was added and the reaction stopped by 

freezing. The reaction could be stored at -20°C up to a month before use. DNA 

synthesis was monitored by agarose gel electrophoresis as the synthesised DNA 

ran slower than the ssDNA and could be differentiated from the double stranded 



Chapter 2 Materials and Methods 35 

RF DNA After determining that the synthesis reaction was successful, 3-10uL of 

the reaction was used to transform 300J,LL of competent MV1190, which were then 

plated on LB plates with a lawn of an overnight culture of MV1190. 

2.3.8. Growth of Resultant Plaques 

The following day, 10-20 plaques were picked and the phage were suspended 

in 150J,LL sterile TE. The phage isolates were then plaque purified twice by pour 

plating the phage on MV1190 as described previously and picking the resulting 

plaques which were then grown up as discussed above and screened as described 

below. 

2.4. Cesium Chloride Banding of Large-Scale Plasmid DNA Preparations 

A one litre cUlture of transformed LE392 was centrifuged at 6000 rpm for 

15 minutes at 4°C and the pellet resuspended in 36mL of solution I (see above). 

After incubating for 10 minutes at room temperature, 80mL of solution II was 

added and incubated for 5 minutes on ice. After addition of 40mL of solution 

III, the contents were incubated on ice for an additional 15 minutes. The contents 

were then centrifuged for 10 minutes at 6000 rpm, the supematent was filtered 

through cheese cloth, and 0~6 volumes of isopropanol were added. The contents 

were mixed and centrifuged for 15 minutes at 6000 rpm. The pellet was 

resuspended in 5mL 0.1X SSC (3M NaCl, 0.3M Sodium Citrate), centrifuged at 

10,000 rpm for 10 minutes and adjusted to 5mL with 0.1 SSC. Then 2.0mL of 



Chapter 2 Materials and Methods 3 6 

1mg/mL pronase 0.8% SDS was added and the mixture was incubated at 37°C 

for 30 minutes. Then 8.4g of CsCl was added, dissolved, and the contents were 

centrifuged at 10,000 rpm for 10 minutes. The supematent was then transferred 

to Beckman polyallomer VTi 65.1 ultracentrifuge tubes, which were then capped 

with light paraffin oil and 250J.£L of 6 mg/mL ethidium bromide (EtBr). The 

tubes were sealed by heat and mixed. Centrifugation took place in a Beckman 

ultracentrifuge at 55,000 rpm for 15-18 hours using a Beckman Vti 65.1 rotor. 

Plasmid bands were collected from the tube using a 18G1/2 or 20G11/2 needle 

and allowing the band to drip into a 15mL polystyrene tubes (Corning). The 

plasmid was then cleaned up by 3 extractions of equal volumes of isopropanol 

saturated with 20X SSC and then dialysed in 1X TE overnight. The following 

morning the TE was changed and dialysis continued for another 6-8 hours. The 

DNA was ethanol precipitated, dried, and resuspended in 50-150J.£L TE. 

2.5. Determination of DNA Concentration 

Concentration of DNA preps was determined as outlined in Maniatis et aL 

(1982). Briefly, the DNA prep was diluted 1:500 in sterile ddH20 and the 

absorbence at 280nm and 260nm was determined. An OD260 of 1 is roughly 

equivalent to 50 JLg/mL double stranded DNA, 40J.£g/mL single stranded DNA, 

and 20J.£g/mL for oligonucleotides. A pure preparation of DNA has a 

OD260/0D280 of 1.8 and any contamination would significantly r~duce that value. 



Chapter 2 Materials and Methods 3 7 

2.6. Enzyme Reactions 

2.6.1. Restriction Endonuclease Digests 

Restriction endonucleases were purchased from Pharmacia, Bethesda 

Research Laboratories (BRL ), or New England Biolabs. Digests were done at 

37°C or at 60°C in the case of BstEII for 4 hours, using 1 unit of enzyme for 

each mg of DNA Digests using BstEII, Hind II, and Pstl were carried out in a 

buffer of 50mM Tris-HCI pH 8.0, 10mM MgCl2, and 50mM NaCl, while digests 

using Bglii were carried out in a buffer of 50mM Tris-HCl pH 8.0, 10mM MgC12, 

and 100mM NaCl. 

2.6.2. T4 DNA Ligase 

The T4 DNA ligase was purchased from Pharmacia. The DNA fragments to 

be ligated were combined such that the smaller insert that was to be mutagenized 

was in 5 to 10 fold molar excess over the DNA it was to be cloned into. To this 

mixture was added O.SmM ATP, 20mM Tris pH 7.6, 10mM DTT, 10mM MgCl2, 

and one unit of T4 DNA ligase. The reaction was incubated at room temperature 

for a minimum of 4 hours. This mixture was then used directly to transform the 

appropriate competent cells. 



C~apter 2 Materials and Methods 3 8 

2.7. DNA Gel Electrophoresis 

2.7.1. Agarose Gel Electrophoresis 

Agarose gels were generally made to 1% agarose (BRL) which was dissolved 

in Tris-Borate (TBE) buffer (0.089M Tris-borate, 0.089M boric acid, and 0.002M 

EDTA) by boiling, which once cooled to about 42°C started to solidify. Prior to 

this the gel was poured into a horizontal gel apparatus and then allowed to 

solidify. Loading buffer (20% glycerol, 2% SDS, and 0.5% bromophenol blue) was 

added to the DNA sample at a ratio of approximately 1:5. Between 10 to 30J.LL 

of DNA sample was loaded in each well, depending on the thickness of the gel, 

after the tank was filled with TBE. Once the gel had run it was emersed in water 

or TBE containing 0.5J.Lg/mL EtBr and allowed to soak 15 to 45 minutes. Mter 

soaking the gel was photographed under UV light with a mounted Polaroid 107 

camera and high speed Polaroid 667 film. 

2.7.2. Polyacrylamide Gel Electrophoresis (PAGE) 

Polyacrylamide gels were made with 5% Acrylamide (Bio-Rad, 30% 

acrylamide, 1% N-N' Methylene-bis-acylamide). For polymeration of the gel 

200J.LL of Ammonium persulfate (APS) and 90uL of TEMED (Bio-Rad, 

N,N,N' ,N'-Tetra-methylethylenediamine) was added. The gel upon polymerization 

was placed in a vertical gel apparatus and up to 30J.LL of sample was loaded per 



Chapter 2 Materials and Methods 3 9 

well. DNA bands were visualized in the same manner as with agarose gels. 

2.7.3. Extraction of DNA Fragments from Polyacrylamide Gels 

Isolation of DNA from polyacrylamide gels was performed as in Maniatis et 

aL, 1982. Briefly, polyacrylamide gels were run and stained as described above. 

Using a long wavelength UV lamp the DNA band of interest was located and cut 

out with a sharp scalpel blade. The gel fragment containing the DNA was placed 

in a 1.5mL Eppendorf tube and was crushed with a teflon plunger. To the crushed 

gel was added 600J,£L Elution Buffer (0.5M ammoriium acetate and 1mM EDTA 

pH8.0) and the mixture was vortexed. The tube was then wrapped in foil and 

placed on a rotator (Labindustries) at 3rc overnight. The next day,the tube was 

centrifuged for 10 minutes in a microfuge and the supernatent was removed and 

kept. To the "pellet" was added an additional 300J,£L of Elution Buffer, the tube 

was spun as before, and the. supematent was pooled with that previously collected. 

The supematents were then filtered through a small column of glass wool and 

ethanol precipitated twice. The DNA was then washed with 70% ethanol, dried, 

and resuspended in 10J,£L TE. 

2.8. DNA Sequencing 

DNA sequencing was conducted as per instructions outlined m the 

T7SequencingTM Kit from Pharmacia. 



Chapter 2 Materials and Methods 40 

2.8.1. Annealing of the Primer to ssDNA 

Single-stranded DNA was prepared as outlined above. The concentration of 

the single-stranded template was then adjusted to 0.2J.£g/uL and the concentration 

of the primer was adjusted to 0.8J.£M. To a 1.5mL Eppendorf tube was added 

10J,£L template, 2J,£L primer, and 2J.£L Annealing buffer. The reaction was then 

vortexed, centrifuged briefly, and incubated at 60°C for 10 minutes. The tube was 

placed at room temperature for 10 minutes before proceeding to the sequencing 

reactions. 

2.8.2. Annealing of the Primer to dsDNA 

Concentrations of DNA components were adjusted as before. The dsDNA 

was denatured by adding 2J,£L of 2M NaOH to the template and incubating at 

room temperature for 10 minutes. The DNA was ethanol precipitated, dried, and 

resuspended in ddH20 and the annealing buffer and primer were added and 

incubated at 37°C for 20 minutes. The reaction was left at room temperature 

prior to proceeding to the sequencing reactions. 

2.8.3. Sequencing Reactions 

The T7 polymerase was diluted to 1.5 units/J,£L with cold enzyme dilution 

buffer. Four 1.5mL Eppendorf tubes were then labelled A, G, T, and C. To "read 

short" (up to 500 nucleotides) 2.5J.£L of the appropriate nucleotide mix-Short was 



Chapter 2 Materials and Methods 41 

added to each tube while to read long (up to 1000 nucleotides) the appropriate 

mix-long was added to each tube. To the tube containing the annealed primer and 

template was added 3J.£L Labelling mix ( dCfP, dGTP, and DTTP in solution), 

10uCi [a-35S]dATP, and 2J.£L of the diluted 17 DNA polymerase. The reaction 

was incubated at room temperature for 5 minutes. After the 5 minute labelling 

period 4.5JLL of the Labelling reaction was added to each of the four sequencing 

mixes, which had been prewarmed at 3rc and allowed to incubate at 3rc for 

5 minutes. After 5 minutes, 5J.£L of stop solution (95% deionized formamide, 

20mM N~EDTA, 0.05% Xylene Cynol FF, and 0.05% Bromophenol Blue). The 

sample to be loaded was then heated at 80°C for 2 minutes and was kept at this 

temperature until loading of the gel was complete. Approximately 1-2J.£L of 

sample was loaded in each well and the gel was run with additional loading of 

sample if required. 

2.8.4. Gel System 

The gel used for sequencing was a 6% polyacrylamide (38:2 acrylamide:bis­

acrylamide) in TBE with 42% w/v urea. The gel was run in a 2010 vertical 

-Macrophor Electrophoresis Unit (LKB Bromma) and the temperature in the 

constant circulating plate kept at 55°C. The gel was prerun at 1800V for 30 

minutes, the samples were loaded, and run at 3000V for 1.5 to 3 hours as 

required. The gel was placed in 10% acetic acid, 10% methanol for 20 minutes 

and then was dried in an oven at 80°C for approximately 2 hours. 



Chapter 2 Materials and Methods 4 2 

2.9. Tissue Culture 

2.9.1. Media and Equipment 

Forma Scientific (Caltec Scientific) or National (Wernicke) incubators set at 

37°C, 95% air, and 5% C02 were used for growth of all cell types and all 

protocols requiring incubation. All sterile work was done in SterilGARD (Baker 

Co., inc.) or Caltec Scientific hoods. Cells were cultured in 60mm or lOOmm 

dishes (Corning) or 150mm dishes (Nunclon). Media used were either Fll 

minimal essential medium (F11 MEM), alpha minimal essential medium 

(a-MEM), or Joklik's modified medium. Sera used were fetal bovine serum 

(FCS), newborn calf serum (NCS), and horse serum (HS). Also used were 

Penicillin-Streptomycin (Pen-Strep, Gibco lOOX solution contains 10,000J.Lg/mL 

penicillin and 10,000J.Lg/mLstreptomycin, 1% L-glutamine, and fungizone ( Gibco ). 

Other reagents include 1X phosphate buffered saline double minus (PBs=, 8g 

NaCl, 0.2g KCl, 1.15g Na~04, 0.2g KH~04, made to 1 litre with ddH20), 

PBs++ (PBS with 0.1mg/mL CaC12 and 0.1mg/mL MgC12l, 1X trypsin-EDTA 

(dilution of 5.0g/100mL trypsin (Gibco) and 2.0g/100mL EDTA in 1X PBS), and 

1X citric saline ( made from lOX stock: 50g KCI, 22g Na-citrate in 500mL 

ddH20). 



Chapter 2 Materials and Methods 43 

2.9.2. Cell Lines 

293 cells are a human embryonic kidney cell line that had been transformed 

by adenovirus 5 DNA (Graham et aL, 1977) and were maintained in Fll MEM 

supplemented with 10% FCS, 1% lrglutamine, 1.25% amino acids,l.25% vitamin 

supplement, 1% fungizone, and 1% Pen-Strep. KB cells are an epidermoid 

carcinoma derived cell line (Eagle, 1955) and were maintained in a:-MEM 

supplemented with 10% FCS, 1% L-glutamine,and 1% Pen-Strep. Hel..a cells are 

an epitheloid carcinoma derived cell line (Gey et aL, 1952) and were maintained 

in a:-MEM supplemented with 10% NCS, 1% L-glutamine, and 1% Pen-Strep. 

2.9.3. Passaging of Cells 

For passaging of 293, when the cells had reached confluency the medium was 

removed and the cells were washed with approximately 5mL of citric saline. After 

the citric saline was removed, an additional 2mL citric saline was added and 

removed and the cells were incubated for 3 minutes at 37°C. After incubation the 

cells were manually dislodged by striking the dish against the side of the hood and 

the cells were returned to the incubator for an additional 2 minutes. The cells 

were then "banged" again, resuspended in media, and plated in 60mm, lOOmm or 

150mm plates. KB and Hel..a cells were passaged in a similar manner except that 

the cells were washed with PBS and Trypsin-EDTA was used instead of citric 

saline. 

http:acids,l.25


Chapter 2 Materials and Methods 4 4 

2.10. Transformation of Primacy Baby Rat Kidney BRK Cells 

2.10.1. Preparation of BRK Cells 

Week old Wistar rats were obtained and sacrificed by cervical dislocation. 

The kidneys were removed and placed in a tissue culture dish containing PBS=. 

Excess tissue and blood vessels were carefully removed from the kidneys using 

forceps and the cleaned kidney was placed in fresh PBS=. All the cleaned kidneys 

were placed in a sterile 100mL bottle and were broken up with long handled 

scissors until the mixture became "soupy" in appearance. Ten (10) mL of 2X 

trypsin in PBS was added to the cells and the entire mixture transferred to a new 

bottle containing 30m.L 2X trypsin. The cells were then stirred at a medium speed 

for 15-20 minutes. The mixture was allowed to settle for approximately 30 minutes 

and the supernatent was transferred to a fresh 100mL bottle containing ice cold 

FCS to stop the trypsin digestion. New trypsin (30m.L) was added to the debris 

and the procedure repeated and the supernatents combined and centrifuged at 

3000 rpm for 5 minutes in 50mL Falcon tubes (Corning). The cells were 

resuspended in a-MEM (10% FCS, 1% L-glutamine, and 1% Pen-Strep) and 

incubated at 3~C for 15 minutes. The cells were filtered through double thick 

cheesecloth and medium added ( 60m.L per pair of kidneys). The cells were then 

plated in 60mm plates using 5m.L cell suspension per plate and incubated at 3~C 

overnight. The following morning, the medium was changed to eliminate dead 

cells and other debris. The cells were allowed to grow to 70-80% before 



Chapter 2 Materials and Methods 4 5 

transfection. 

2.10.2. DNA-Mediated Transfection of BRK cells 

The BRK cells were transfected by the calcium phosphate method of Graham 

and van der Eb (1973) as modified by Wigler et aL (1979). Generally 5J.Lg 

plasmid/ 60mm dish BRK was added to a 15mL polystyrene centrifuge tube 

(Corning) along with 5J,Lg salmon sperm DNA/60mm dish BRK, and ddH20 to 

0.9mL. Then 100ML 2.5M CaC12 was added and the mixture was added drop by 

drop to 0.25mL 2X HbS (8g NaCl, 0.37g KCl, 0.125g NcyiP04, S.Og Hepes 

[Calbiochem], l.Og dextrose, pH 7.1) per dish BRK cells. While the CaC12 mixture 

was being added the 2X HbS was bubbled by passing air through the mixture. 

After the plasmid mixture had been added, the mixtures were allowed to incubate 

at room temperature for 30 minutes. Then O.SmL of the precipitate was added to 

each of 4-8 60mm dishes of BRK with SmL of a-MEM medium and were left 

overnight to allow uptake of the DNA The next morning the media was changed 

with fresh a-MEM. Selection for transformed cells was done by changing the 

medium to Jokliks medium supplemented with 5% HS, 1% L-glutamine, and 1% 

Pen-Strep, 4 days post-transfection. The medium was changed every 3-4 days for 

approximately 2-3 weeks, when the cells were fixed with 3:1 methanol/acetic acid 

for 30 minutes, dried, and Giemsa stained (Fischer Scientific, diluted 1 in 20 with 

PBS). Transformed colonies were then counted and viewed under the microscope 

for confirmation if required. 



Chapter 2 Materials and Methods 46 

2.11. Rescue of Mutations into Infectious Virus 

Mutations were rescued into virus by the method of McGrory et al. (1988). 

Briefly, pJM17 (McGrory et al., 1988) is a non-infectious plasmid, which is a 

derivative of pFG140 (Graham, 1984), a derivative of dl309 (Jones and Shenk, 

1979) that contains a 4.3 Kb insert that disallows packaging of the genome into 

the viral capsid. All mutations were rescued into plasmid pXC38 (McKinnon et 

aL, 1982) that contains the leftmost 22 to 5788 base pairs of the Ad 5 genome. 

Cotransfection of 293 cells with these two plasmids resulted in recombination 

between the two plasmids that created an infectious virus that was packaged 

normally. The virus was then screened for the mutation(s) by restriction analysis. 

2.11.1. Transfection of 293 Cells 

293 cells were passaged as described above into 60mm dishes and were 

transfected when they reached a confluency of 70-80%. Transformation was 

performed as described above with the following differences. In addition to the 

5J.£g/dish of the plasmid carrying the mutation, 5J.£g/dish of pJM17 (McGrory et 

aL, 1988) was used. The CaC12 cocktail when added to the 2X HbS was not 

bubbled but was instead merely added carefully drop by drop. The precipitate was 

added to the cells as described previously and the cells were incubated at 3rc 

for 4-5 hours to allow the uptake of the DNA After incubation the medium was 

removed and the dishes were overlayed with 10mL Fll that was supplemented 

with 5% HS, 1% fungizone, 1% L-glutamine, 1% Pen-Strep, and 1% agarose. The 



Chapter 2 Materials and Methods 4 7 

dishes were then returned to the incubator at 37°C and plaques were generally 

visible in just over a week. The cells were usually fed with fresh F11 and 1% 

agarose sometime midway during the incubation period. 

2.12. Screening of Viral Recombinants 

2.12.1. Harvest of Plaque Isolates 

Plaques were picked using a sterile pasteur pipet and transferred to 250J.£L 

of PBs ++ containing 10% glycerol. These isolates could then either be stored at 

-70°C or expanded immediately if 293 cells were ready. To expand the agarose 

plug, either an aliquc! of the PBS suspension or the entire plug was used to infect 

293 cells 80-90% confluent. After allowing the virus to absorb for 60 minutes, 

fresh Fll with 5% HS, 1% L-glutarnine, and 1% Pen-Strep was added to the dish. 

2.12.2. Harvest of Liquid Infections and Extraction of DNA 

The harvest of liquid infections was performed in one of two methods 

depending on the virus. If only the recovery of the virus was desired then the 

medium was removed in a sterile hood and transferred to a 15mL Corning tube. 

Some medium was left on the cells which were carefully scraped using a rubber 

scraper and transferred to tube containing the medium. The cells were then 

pelleted at 1000 rpm and the supernatent sterilely transferred to a new Corning 

tube containing 100% glycerol. The pellet was resuspended in 1-2mL fresh 



Chapter 2 Materials and Methods 48 

medium and freeze-thawed 3 times in liquid N2 and in a 37°C water bath. The 

suspension was then centrifuged at 1000 rpm and the supematent transferred to 

4mL glass vials (containing 0.250mL glycerol) in O.SmL aliquots, which were then 

stored at -70°C until required. On the other hand, if recovery of viral DNA was 

required a Hirt extraction (Hirt, 1967) was performed. The medium was again 

removed in a sterile hood and saved. To the dish was then added 0.8mL of 0.6% 

SDS in lOmM Tris-EDTA (pH 7.5) and left at room temperature for 20 minutes. 

The cells were then scraped gently into l.SmL eppendorf tubes. After addition of 

200J,£L of SM NaCl, the mixture was left overnight at 4°C. The following morning 

the contents were centrifuged in a microfuge for 30 minutes at 4°C and the 

supematent recovered. The DNA was then treated with RNase ( 40J.£g/mL final 

concentration) and then with Proteinase K (50J.£g/mL final concentration). The 

sample was then phenol/chloroform extracted twice, ethanol precipitated, washed 

in 70% ethanol, dried, and resuspended in 100J,£L ddH20. Of this resuspension 

10-30 J.£L were used for restriction analysis depending on the DNA concentration. 

Other than digesting with the restriction enzymes characteristic of the mutations, 

viral DNA was digested with Hindill or Pstll to test for gross rearrangements that 

may have arisen though undesired recombination events. Samples were run on · 

1% agarose gels and visualized by EtBr staining or by Southern blot analysis (see 

below). 



Chapter 2 Materials and Methods 49 

2.12.3. Southern Blot Analysis 

Southern transfer was carried out by the method of Southern (1975) as 

outlined in Maniatis et aL (1982). Briefly, after running the 1% agarose gel, the 

gel was treated with O.SM NaOH, 1M Nael for 1 hour, changing the solution 

after 30 minutes. The gel was rinsed with ddH20 and neutralized with 3M Nael, 

O.SM Tris (pH 7.4-7.5) for 2X 30 minutes. The DNA was then transferred to 

nitrocellulose overnight by the procedure outlined in Maniatis et aL (1982) using 

lOX SSe. After transfer, the nitrocellulose was washed in 6X SSe for 5 minutes 

with shaking, air dried, and baked at 80°e in an oven for 1.5-2 hours. Prior to 

prehybridization, the nitrocellulose was soaked in 6X SSPE (3M Nael, 200mM 

NaH2P04:H20, 20mM EDTA pH7.4). Prehybrization took p!ace in vacuum sealed 

(Decosonic) bags using 6X SSPE, 0.5% SDS, SX Denhardt's solution (SOX 

solution: Sg Ficoll, Sg polyvinylpyrrolidone, Sg BSA, ddH20 to 500mL, filtered, 

and stored at -20°e) all at TH ([2°ejAorT of oligo + 4°ejGor e of oligo]-5°e). 

Hybridization of the oligonucleotide took place overnight at TH• using 200ng/mL 

tRNA and 1-10x106 cpm/mL of the oligo probe. The oligonucleotide was labelled 

by the procedure outlined above for phosphorylating an oligonucleotide of Zoller 

and Smith (1983) using 100J.£Ci r-32PATP (New England Nuclear [NEN]). After 

hybridization, the nitrocellulose was washed in 2X SSPE/0.1% SDS 3 X 20 

minutes at room temperature and 1 X 20 minutes at T H· The blot ·was then 

airdried, put on 3MM paper, wrapped in clear plastic wrap, and exposed on 

Kodak XR-5 fast (X-ray) film at -70°C. 



Chapter 2 Materials and Methods 50 

2.13. Plaque Purification of Viral Recombinants 

After the viral recombinant had been identified by the procedures above, 

293 cells in 60mm dishes were infected from the virus-containing medium from 

the expanded agarose plug, that had been serially diluted in F11. The dishes were 

then overlayed with F11 with 1% agarose as described above. After one week, 

a plaque was isolated and expanded into a liquid infection of 293 cells. The DNA 

was recovered and analyzed as outlined above, and if the virus proved to be 

correct the process was repeated using the medium from the first purification 

step. After the second purification, the virus was recovered by freeze-thawing and 

transferred to 4mL dram vial, which was then stored at -70°C and used as a stock 

for future work. 

2.14. Determination of Virus Titres 

HeLa and /or 293 cells were split into 60mm dishes and were infected when 

they reached 80-90% confluency. The viral stock was diluted serially from 10-3 

to 10-10 and O.SmL was used to infect the cells. After an absorption period of 60 

minutes the dishes were overlayed with Fll supplemented with 5% HS, 1% 

fungizone, 1% lrglutamine, 1% Pen-Strep, and 1% agarose. Plaques were counted 

over a period of 7-9 days post-infection. The procedure was repeated with 

different cells and results were calculated as pfu/mL and these numbers were 

used for future infection where a certain multiplicity of infection (moi) was 

required. For comparing the titres on 293 and HeLa cells, the ratio between 293 



Chapter 2 Materials and Methods 51 

and HeLa titres for the mutant was expressed relative to the ratio between 293 

and He La cells for dl309 (the wild type virus). 

2.15. Protein Analysis 

2.15.1. Preparation and infection of Cells 

KB cells were cultured in lOOmm dishes (Corning) in a-MEM supplemented 

with 10% FCS, 1% L-glutamine, and 1% Pen-Strep and were maintained as 

described above. 293 cells were cultured in 100mm dishes in Fll supplemented 

with 10%FCS, 1.25% amino acids, 1.25% vitamins, 1% L-glutamine, 1% 

fungizone, and 1% Pen-Strep. Cells were infected at an moi of 35 pfu/cell (Rowe 

et al, 1983). 

2.15.2. Antisera and Immunoprecipitation 

Antisera (peptide) to the amino termini of the 496R, 84R, 93R, and 156R 

proteins (termed 58N-2) and to the carboxy termini of 84R, 93R,and 496R 

proteins (termed 84-C2, 93R-C1, and 58-C1 respectively), were made available 

and described elsewhere (Brown et al, in progress; McGlade et al., 1987; and 

Yee et al, 1983). Cells were labelled from 16-18 hours post-infection with 

100-250J,£Ci [35S]methionine (Amersham Corp.; specific activity 1,300 Cijmmol) 

and harvested at 18 hours post-infection. At this point the medium was removed 

by aspiration and the cells were gently scraped using a rubber scraper. The cells 



Chapter 2 Materials and Methods 52 

were resuspended in 2mL cold PBS and transferred to a 15mL Falcon tube. The 

dish was washed with 2mL of fresh cold PBS and the suspension was added to the 

first. The cells were then centrifuged at 2000 rpm for approximately 5 minutes in 

a Chilspin 2 (MSE), the supernatant was removed, and the cell pellet resupended 

in cold PBS. The resuspension was centrifuged once more and the wash procedure 

repeated. The pellet was this time resuspended in cold RIP A buffer (50mM Tris, 

150mM NaCl, 1% Na Dodecylcolate, 0.1% SDS, 1% Triton X, 100u Aprotinin, 

pH 7.2) at a quantity of 0.5mL per immunoprecipitation reaction. The 

resuspension was then vortexed briefly and centrifuged at 10,000 rpm for 10 

minutes (Sorvall). The supernatant was removed and saved as cell extract. The 

immunoprecipitation reactions were set up by adding 100-200;.t!... Protein A 

Sepharose CUB Beads (Pharmacia), 0.5mL cell extract, 10-30J.£L antiserum, and 

peptide if a chase was desired. The reaction tubes were rotated end over end for 

at least 4 hours and usually overnight, before being centrifuged, aspirated, and 

washed 3X with RIP A and 2X 5M LiCl. The sample was then resuspended in 

sample buffer (10% Stacking buffer [see below], 1% SDS, 10% glycerol, 0.1% 

B-mercaptoethanol, 50mM Tris-HCl pH 6.8, and 0.001% bromophenol blue) and 

boiled prior to approximately 30uL being loaded per well. 

2.15.3. SDS Polyaczyamide Gel Electrophoresis (SDS-PAGE) 

SDS-PAGE was performed as described previously (Yee et aL, 1983). The 

separating gel was usually 15% polyacrylamide, while the stacking gel was 5%. 



Chapter 2 Materials and Methods 53 

The ratio of N-N'bismethylene acrylamide to acrylamide was 1:30. The separating 

buffer was 1.5M Tris-HCl (pH 8.8), while the stacking buffer was O.SM Tris-HCl 

(pH 6.8). The gel was ran overnight at constant current such that the voltage 

varied from 50 to 150V over the 12-16 hours. The gel was then fixed with a fixing 

solution of isopropanol, water, acetic acid (25:65:10) and scintillated for 30 

minutes in Amplify (Amersham). Following this the gel was dried over a steam 

dryer under vacuum and visualized by Kodak XR-5 film. 



Chapter 3 Results 54 

RESULTS 

3.1 Characterization of the Minor E1b Products. 

This study involved the analysis of the function of the E1b minor products 

156R and 93R, through the generation of mutants that affect the individual 

acceptor sites of the 1.26 and 1.31Kb messages. The resulting mutants, which were 

hopefully deficient in the production of 93R or 156R, were tested for their ability 

to transform primary rat cells by DNA mediated assays and their ability to carry 

out productive infection in human cells. 

3.2 Site Directed Mutagenesis of the 3' Splice Sites of the 1.26 and 1.31Kb 

messages. 

3.2.1 Cloning into M13 

Adenovirus type 5 sequences were obtained from the plasmid pXC38, which 

contains the adenoviral sequences from bases 22 to 5788 (the first 16%) and thus 

all of E1a and E1b (McKinnon et al., 1982). A working fragment of 524 base 

pairs was cloned from pXC38 that ranged from the restriction endonuclease 

Hindlll site at 2804 to the Bglll site at 3328 in the Ad sequences and which 

contained the splice acceptor sites for both the 1.26 and 1.31Kb mRNAs (Figure 

3.1). The fragment was isolated, after digestion with restriction enzymes, by 

elution from a 5% polyacrylamide gel as described in section 2.7.3. This fragment 



55 

Figure 3.1 Schematic Representation of the Plasmid pXC38. Also shown 

is the 524 base pair "working" fragment from the Hindlll restriction 

site at 2804 to the B~:lii site at 3328 of the adenovirus genome. The 

sequence around the splice acceptor sites of the 1.26 and 1.31Kb 

mRNAs (labelled 156R and 93R splice acceptors, respectively) is also 

shown, with the 93R stop codon labelled as well. The nucleotide 

numbers given refer to the nucleotide numbers as found in the intact 

wild type virus and start with the letters bp, meaning base pair. 



pXC38 

E1b 

bp5788 

bp2804 

TTTGGGTAACAGGAGGGGGGTGTTCCTACCTTACCAATGCAATTTGAGTCACACTAAGATATTGCTTGAGOCCG 

bp3206 T T Tbp3279 

93R Splice 93R Stop 156R Splice
Acceptor Acceptor3260 

3218 3276 



Chapter 3 Results 57 

was subsequently cloned into the M13mp18 cloning vector in the multicloning 

polylinker at the Hindlll and BamHI sites, which creates a new Xholl site at the 

Bglii/BamHI site, as the overhanging sequence for all three enzymes are identical 

(Figure 3.2). The fragment could be recovered by digestion with the enzymes 

Hindlll and Xholl, which would rescue the Bglll site in the working fragment. 

After ligation of the adenoviral sequence into M13, the cloned M13 was used 

for the transformation of E. coli MV1190 cells. The polylinker sequences in M13 

are located near the start of the lac DNA of the a-galactosidase gene, which is 

found in the intergenic region of the bacteriophage between phage genes IV and 

II. Any inserted DNA in the polylinker was expected to disrupt the a­

galactosidase gene, resulting in the formation of clear plaques. Following 

transformation and plating, clear plaques were picked and the cloned phage was 

expanded. For confirmation of the presence of the insert, DNA was isolated and 

screened by digesting the cloned M13 with Hindlll and Xholl, followed by 

agarose gel electrophoresis. The expected restriction fragments are shown in 

Figure 3.5 and include a 700 base Xhoii-Xhoii fragment, the 524 base Hindiii­

Xhoii fragment, and a third Xholl-Hindlll fragment that consists of the 

remainder of the M13 vector. The pattern of DNA fragments resulting from 

digestion with Xholl and Hindlll are shown in Figure 3.6, lanes A-D. 



58 


• 	 Figure 3.2 Cloning into and out of M13. A: Shown in the upper portion 

are the parental plasmid pXC38 and the bacteriophage M13mp18, 

with the restriction sites used in the cloning labelled in the 

appropriate places. Arrows pointing down indicate digestion with the 

enzymes listed next to the arrows and subsequent ligation of the 

pXC38 fragment into the M13 vector, with the Hindlll and the newly 

created Xholl site labelled (below). The arrow pointing up indicates 

digestion with the enzymes listed to the left of the arrow, used in the 

rescue of the mutated fragment back into pXC38. B: Shown here are 

the 5' overhanging sequences of the BamHI and B2III sites and the 

subsequent ligation and formation of the new Xholl site. 



A 

Hird Ill .~ 

'~ndlli+Bglll 

Hindii+Xholl "'------,.------I 
6238, Hi rd Ill 

B BamHI Bglll 
5' ... A GATCC ... 3' 
3' ... TCTAG G ... 5' 

\ I 
5' .. . JGATCC ... 3' 
3' ... TCTAGf ... 5' 

Xholl 



Chapter 3 Results 60 

3.2.2 Oligonucleotide-directed Mutagenesis. 

The mutagenic oligonucleotides used were 21mers, with 10 nucleotides on 

either side of the mutated nucleotide (Figure 3.3). This size was used in order to 

achieve as high a degree of stringency and efficiency of priming as possible. 

Figure 3.3 shows the steps in M13 mutagenesis. Briefly, the method involves the 

hybridization of the mutagenic primers to the M13-adenoviral clone followed by 

extension of the primer by T4-polymerase. The clone template used has uracil 

incorporated into the DNA rather than thymidine (due to growth of the phage 

clone in CJ236, which lacks the enzymes dUTPase and uracil N-glycosylase ), while 

the newly synthesized DNA strand is normal. This situation allows for selection 

of the new mutated strand on transformation into MV1190 (see 2.3.7), with the 

uracil-incorporated strand being inactivated at high efficiencies by uracil N­

glycosylase. 

The actual mutations introduced into the DNA were planned in such a way 

as to meet several criteria. First of all the mutations must involve either the 

terminal A or G of the intron, or any of the other nucleotides of the splice site 

consensus sequence known to disrupt splicing (Sharp, 1987; see Discussion). 

Secondly, the mutations must be conservative changes and not change the coding 

sequence for the 496R protein to ensure that any resulting phenotype is due to 

the loss of the minor protein and not to any potential change in function of 496R. 

This can be achieved by taking advantage of the degeneracy of the genetic code 

(Table 3.1). Finally, for screening purposes the mutations were designed to 



61 

Figure 3.3 M13 Mutagenesis. A: The sequence of the 21mer oligonucleotide 

mutagenic primers, with the respective mutated nucleotide indicated 

by an underline. B: A schematic representation of the steps in 

mutagenesis. The cloned M13-Ad5 template is shown with uracils 

incorporated into the DNA sequence as well as two of the 

complementary nucleotides of the binding site of the mutagenic 

primer. The next steps involving the hybridization of the primer (in 

the case shown oligo #1-93) to the template, followed by elongation by 

T4 DNA Polymerase, and ligation are also shown. These steps are 

followed by transformation of E. coli MV1190 cells, which leads to 

inactivation of the uracil incorporated strand and selection of the 

mutated strand. 



A 

Oligonucleotide # 1-93 

TTTGGGTAACCGGAGGGGGGT 

Oligonucleotide # 2-156 

TATTGCTTGAACCCGAGAGCA 

B rTC~ ptTGGGTAACCGGAGGGGGGTQH r~
c::J c::JH~RID~TI~ 


T4 DNA Polymerase! 
T4 DNA Ligase 

transformation 

M13-Ad5 of MV1190 




Chapter 3 Results 63 

introduce a change in the restriction endonuclease digestion pattern by adding or 

removing a site. 

Observance of the above criteria is outlined in Figure 3.4. In order to disrupt 

the splicing of the 1.31Kb message that produces the 93R protein, the adenosine 

(A) of the AG 3' splice acceptor was converted to a cytosine (C). Changing this 

nucleotide has no effect on the amino acid coding sequence for 496R (Table 3.1). 

The conversion of A to C also created a new EstEll site, whose recognition 

sequence is GGTNAACC. In the case of the mutation disrupting the 1.26Kb 

mRNA and subsequently the production of 156R, the G of the AG consensus 

sequence was mutated to an A. The resulting codon change in the 496R coding 

sequence was a GAG to a GAA, which conserved the glutamic acid codon at that 

site (Table 3.1). The nucleotide change also eliminated a Barril restriction 

endonuclease site, which has a recognition sequence of G(Pu)GC(Py)C. The gain 

of a restriction site in the one case and the loss of a site in the other allowed for 

a rapid screening procedure for the presence of the mutations. Figure 3.5 outlines 

the expected DNA fragments produced from a digestion of the M13-93R and 

M13-156R mutants by digestion with Hindiii/BstEII and Hindlii/Banll, 

respectively. The predicted restriction pattern for the M13-93R mutant, digested 

with Hindlll and EstEll, would be to create a single 409 base fragment due to the 

addition of the EstEll site, while the wild-type (the M13-adenoviral clone) would 

yield only the linearized genome, cut at the Hindlll site. The elimination of the 

Banll site in the M13-156R mutant would yield a 469 base fragment that would 

shift to a 538 base fragment, which corresponds to a fragment cut at one end at 



64 

Table 3.1 The Genetic Code, Displaying Its Degeneracy 

SECOND POSITION THIRD 
POSITION 
(3' END)u c A G 

pne ser tyr cys u 
phe ser tyr cys c 

- u leu ser stop stop A 
c z 
w 
in-z 
0 
E 
tn 
0 
Q. 

t;
a:
u:: 

leu ser stop trp G 

c 
leu 
leu 
leu 
leu 

pro 
pro 
pro 
pro 

hiS 
his 
gin 
gin 

arg 
arg 
arg 
arg 

u 
c 
A 
G 

A 

lieu 
lieu 
lieu 
met 

thr 
thr 
thr 
thr 

asn 
asn 
lys 
!Y_s 

ser 
ser 
arg 
arg 

u 
c 
A 
G 

G 

val 
val 
val 
val 

ala 
ala 
ala 
ala 

asp 
asp 
glu 
glu 

gty 
gly 
gly 
gly 

• u 
c 
A 
G 

phe: phenylalanine 
leu : leucine 
lieu: Isoleucine 
mat: methionine 
val: valine 
ser: serine 
pro: proline 
thr : threonine 
ala : alanine 
tyr : tyrosine 
his : histidine 
gin : glutamine 
asn: asparagine 
Jys: lysine 
asp: aspartic acid 
glu : glutamic acid 
~s: cysteine 
trp : tryptophan 
arg: arginine 
gly : glycine 



65 

Figure 3.4 The Introduction of the Mutations into the Adenovirus 

Sequence. A: The sequence around the splice acceptor site for the 

1.31Kb mRNA coding for the 93R protein, showing the nucleotide 

sequence, the splice acceptor site (vertical line), the codons for the 

496R protein (underlined), the codons for the 93R protein (overlined), 

and the amino acid sequence and number for both the 496R and 93R 

proteins under and over the nucleotide sequence, respectively. The 

mutated nucleotide is shown in a box, with the actual change shown 

next to the arrow, which indicates the point mutagenesis. }...!so shown 

is the change in the restriction enzyme pattern, which in this case is 

the creation of a BstEII site. Note that in mutating the site there is 

no change in the amino acid sequence of 496R (Table 3.1). B: The 

sequence surrounding the 1.26Kb mRNA is shown as in A, with the 

amino acid sequence of 156R shown, as well as the elimination of the 

Banll site. Note again that the amino acid sequence of 496R is 

unaltered by the mutation. 



A 


lA-c 
(3216) 

GCAIIIGGGTAA@GAGGGGGGTGTT 
Leu Gly Asn Arg Arg Gly Val 

396 397 398 399 400 401 402 


\ I 

Bst Ell 

B 	 80 81 82 

Pro Glu Ser 


AGA TATTGCTTG CCGAGAGCATGT 

lie Leu Leu Glu Pro Glu Ser 

416 417 418 419 420 421 422 


\ I 

Ban II 


G-A 
(3275)

1 

AGATATTGCTT~CCGAGAGCATGT 

lie Leu Leu Glu Pro Glu Ser 

416 417 418 419 420 421 422 




67 

Figure 3.5 The Expected Restriction Fragments of the M13 Vectors. A: 

Shown are the expected fragments produced by digesting the cloned 

M13-Ad (wild type) vector with Hindlll and Xholl. Expected are the 

524 base pair "working" adenovirus fragment, a 700 base pair M13 

fragment, and the remainder of the M13 sequences. B: Shown are the 

expected fragments produced by digesting the M13-93R vector 

containing the 93R splice acceptor mutation, which creates a BstEII 

site, with Hindlll and BstEII. Expected in the mutant are a 409 base 

pair fragment and the remainder of the vector sequences, while in the 

wild type vector only the opened vector is expected. C: Shown are the 

expected fragments produced by digesting the M13-156R vector 

containing the 156R splice acceptor mutation, which leads to a loss of 

a Banll site, with Hindlll and Banll. Expected in the wild type vector 

are a 469 base pair fragment, a 79 base pair fragment, a 594 base pair 

fragment, and the remainder of the vector, while in the mutant vector 

a 538 base pair fragment is expected instead of the 469 and 79 base 

pair fragments. 



524 nucleotides 

M13-Ad 

A Xholl Hind Ill 

BstEII 

B 
Xholl 

M13-93R 

469 nucleotides ,..._____, 

~...----y 
538 nucleotides 

M13-156R 



Chapter 3 Results 6 9 

the Hindill site and at the other end at a Banll site just outside the polylinker 

region in the M13 sequences. Also produced was a 594 base fragment of M13 

sequences (see Figure 3.5) and in the ''wild type" phage a 79 base fragment, which 

was not resolved on the agarose gel. These fragments are seen as the appropriate 

bands on an ethidium bromide stained 1% agarose gel (Figure 3.6). 

The restriction patterns on agarose gel electrophoresis showed clearly that the 

mutations were present in the M13 clones. Yet, in order to ensure that no other 

mutations were introduced into the adenoviral sequence, which could affect the 

coding region of 496R, the entire mutated fragment was sequenced while still in 

the M13 construct. Particular attention was given to the area surrounding the 

mutated site as problems occasionally arise due to difficulties in initiation from 

the primer by the polymerase. The actual mutations were confirmed by this 

procedure, as is shown in Figures 3.7 and 3.8, for the 93R and 156R mutations, 

respectively. Single stranded and double stranded sequencing also confirmed that 

the remaining adenoviral sequences were free of undesired mutations. Double 

stranded sequencing was also performed on the adenoviral sequences upon rescue 

back into pXC38 to ensure that no mishaps occurred during this procedure (data 

not shown). 

3.2.3 Rescue of Mutated Sequences into pXC38 

Wild type pXC38 was digested with Hindlll and Bglll and the larger band 

containing the majority of the pXC38 sequences was purified from a 5% 



70 

Figure 3.6 Restriction Patterns of the Wild Type and Mutant M13 Vectors 

as run on a 1% Agarose Gel. Lane A is the lambda-cpl74 phages 

digested with Hindlll and Hinclll respectively, used as markers with 

the sizes in base pairs shown. Lanes B,C,and D are the wild type, 

M13-93R mutant, and M13-156R mutant, respectively, all digested 

with Hindlll and Xholl, which is indicative of the presence of the 524 

base pair adenovirus insert. Lanes E and F are the M13-93R mutant 

and wild type vector, respectively, digested with Hindlll and BstEII, 

showing the appearance of the 409 base pair fragment in the mutant. 

Lanes G and Hare the M13-156R mutant and the wild type vector, 

respectively, digested with Hindlll and Banll. Shown, as expected, is 

a shift in the mutant to a 538 base fragment from a 469 base pair 

fragment in the wild type. 



A B E 

23130
9416\.
6557~ 
4361..-- ­
2322?-­
2027'' 


770...._,__ 

609..--- 700bp

564­ 594bp
495­

524bp -- 538bp392- 469bp 

~~~ ~ 
2974= 

291 / 


210­



72 

Figure 3.7 Dideoxyribonucleic acid Sequencing of the Region Surrounding 

the 93R Splice Acceptor Mutation. Shown to the left of the 

sequencing gel is the sequence read from the region indicated. A 

indicates an Adenosine, G indicates a Guanosine, T indicates a 

Thymi dine, and C indicates a Cytosine at that position in the 

sequence. The letters along the top refer to the particular 

dideoxyribonucleic acid sequencing mix added to the reaction mixture 

loaded into each lane. The lanes were loaded in such a way as to 

ensure that every reaction mixture was loaded next to every other 

different reaction mixture in the series. 



GATGCATC 


T 

G 

G 

G 

G 

G 
G 
A 
G 
G 

c 

c 

A 

A 

T 

G 

G 

G 

T 

T 

T 




74 

Figure 3.8 Dideoxyribonucleic acid Sequencing of the Region Surrounding 

the 156R Splice Acceptor Mutation. Shown to the left of the 

sequencing gel is the sequence read from the region indicated. A 

indicates an Adenosine, G indicates a Gu~nosine, T indicates a 

Thymidine, and C indicates a Cytosine at that position in the 

sequence. The letters along the top refer to the particular 

dideoxyribonucleic acid sequencing mix added to the reaction mixture 

loaded into each lane. The lanes were loaded in such a wa